Transcript asmbl_22163

Sequence
Transcript Sequence for observation asmbl_22163 of TGE0004232:
GACACTGTAGCCTCAGTCGAGAATCACTCAGATTCACTATCCACTGGTGAACAGGCGGATCCAGCCATAGCCAAACCAAGCATCGTAACAACCAGTGATACGGTCAGTGCAAACACAAAGATGGCACCCAGCGACTCGGAAAAATCGGGGATACCAGCCTCAGACAAGAATATTGCCATTGCTACTGGCTCAAAGACGACTCAAGATCCAGCTCAGAAGTCTATTACACCAACTACTGTCCTGATGAAGACCGAAACCAAAAGCAGCCAGGATGGACTTAAAACTGCACCTGGAACGAAAGTCCAAAGTAGTCCCAGTGTTACTGCGAGCATGACCACGCAGGGAGGTCGCACGGACCTCCAATCTACACAACATCTGAGTAGCTCCACAGACAACAGTCCTGCCCTTTCTTCCTTGACCACCCCAGCGAGCACACAACAGCTGACTCCAGGCTCTCCCAAGGGACCAGACCAAATGACGACAGCTTCAAGTAGTTCAGGCACAACGGCAGGTTACACCTTCACCCCTTCACATCCGAGGACGGCTACCACACTGAGATCATCGATTACCTCGCAAGATCTGCCGACCCCCAGCAAGATGCCAGCCATCACTGGGAACCATTCCTCCACCCCGGGGACCCCTTCCTCCATCCCTGGGATAGCGACTTCTTTGTCCAACACTCTGCAGCCTACGTCTTCATCGGGACCTGTGGCCACATCTTCTGGCGGAACCACAAGCTTCCGTACTCAGTTGGCTCCAACTGCCCCCCAAGACTCCAACATCTCTACTCCCCCCTCGGTTTTCGAGGATGACAGGATAACCTGCACGAAGACCGACCGAAGTCTGAACGAGTCGATGCTCATCTTGAACCTCACGAAAACCGTCCACTGCGCGGGGAGCCCTCTGGATGACAAACTGGTCACACTTCTGTGCCGAGCGGCTAAATCTGCCTTGAACCCAACTCAAGACCAGTGCCACATACATCTGATAGTCAGTTCAGAAGGCCAGGCAGTGGCAGTCGAAGAGATCACTATTCGAACAAAACTCGTTCTTAAGGACGTATATGAATCGCTGAAAGACAAATGGGATGACCTGAAGGAGATGGGAGTCAATGACATGAAGCTTGAGGGTCAAGGACCACCAGATGAGACTGAGGACCGGTTCAGCAAAAAATATTGTCTGCATGGCATCCTTTCTGCTCCTCGTGGCGGCCCTCTATGGCTGCTGCCACCAGCGCCTCTCCCAGAGGAAGGACCAGCAACGACTAACGGAGGAGCTGCAGACCGTGGAGAATGGTTACCATGACAACCCAACACTGGAAGTGATGGAGACCTCATCAGAGATGCAGGAGAAAAAGGTGGTCAACCTTAACGGGGAGCTGGGAGACAGCTGGATCGTCCCCCTGGACAACCTGACCAAGGATGACCTAGATGAGGAGGAAGACACACACCTCTAATCCGGTCTGCTGGCGGCCTCCGACGGTGCCACAGAGCTCCAGACCGGACCACCTCAAGTGCCATTGGGACAGGGGAGGAAAGTCCTTCCCATTTGAGGGAAAGACTGGGGAGGGAGCAGACTTGGAGGGTTCCCTCCTCCTAATCCCGCAAAGGGCCTTAATTTTTCTCTTTCAAACTGAACAAATCATATCCTGTCTAGATTCCTCTTGTAAAATAACCTACTAGTGCCTGAGCTCAGTGCTGCTGGAAGATGAGAGAGAGGAAGGGAAACCAAGAGTGAGCCATACTGGGGACGTAGAGATCAGCTAGTCGAATCCCTTCATTTCACAGATGAGATGACTGAAGCCCGAAGAGGGTAAAGTCAAGGGTGACACAGCCACTTGGTGACAGAGTCAGGATGAAAACAGATTCCTTCCTGCAGGCCAGTGCTCGTTCCACCCTGCCACACTGCTGCGATCCCTCGTGCCCTCCCTCCAGAGCTGCCCCGGGCTGGGGGTGGAGCTGCCAGATGATGGATGGGACAGAAGGGAGAGCAGCGGGGCCCGATCCTGCCTCAGCGGGATCTGGTTCCTTGAAAGCATAGGTCCCAGTTCTGTCTCCTACCCCAGCCTCGTCTGCCATTGTTCTCGTCCCCTTTGTTCTTCCCCTTCCATTCACTCGATTTTTATTCCCATTCTGCCCCAGGATCTTGAGACTAACACAGGTCATTCATGACCTTGAACCCCTTGTCTGGATTCTGGTTTCCTGCCATTTGCTTAGTGAGACTGGGACTTGGACCACACGAGACTCCCAGCGTGAACGAGGTCTGCTTAGGGGTCCGTCTACAGGTGGAGAGCTGGGGAAGCCCTTCCTCCCCGGGTGTGTCCTGGCCCATCACCCAAGGGACTCCCTGAAGAGGCTTCCCAAGTGTTCCATTGGCCTCTCTTCCCCACCAGGGGCTAAATTCCACAGCTAATGAAGGCAAAGGGTTCCTATACTGTTGTTCACTGCTCAGCCAACGGGGGTGAAAATCCCAGCTAGGAAACCCCAAGATTAGCGCGAATGGGCGGCATTCGGACAGACTTTCCCAGGGCCCCAGTCAGCAGAGAGGGCGTCTTGACAGACAATCGAAGGAAGGCCGGGGAGGCTAGGCTCTTCTATTTCATAGGAAACTCAGGGACTTTTCAAGTTGCTGAGAGTTTTGTTATGTTTTCTAACCCAGCCCTCTACTGCCTAAGGCCAAAGCTCAAATTGTAGAGACTTTCAGTGAGCTAAACTCACTGATTAGAGTCTCCTGTGCCATAGGGCAAGAGAGGCCTAGAACATGAGGTGCATTTTAAGGTGCATAACGGGCAGCCCGGGGGCATGGCCGTCTGTCTGTTCTCGGTAACCCCTCACTGTCCTGGCATGGAGCCATGTCCTCTTCTCTGTAGTCCTAGTGGGGCTGCCCTGTTGTCCTGCAGTTTCTGGTAGCATCTCAGGGAAATAAAATACTATCTGTTCCTCAGTAGAGGAGATCTGAGGGGCTCAGCAGTTAGCCACCATGTAGGAAGACTAGGCGTGGTGAGGTTTAATCTGATTTTCTGACGAGAGAATCCTGTGTGGGATTTTGAACTTTGCCCATGGTCACTATTGTTCCTGGGCGTAAGATCCCTGGAATTAACTAGGAAGATGGGCAGCACTGCTTAGGAGAGTGAAAACTGTCATTTCGGGCCAAGAGTCAGAACCCCAGAATGCAGAGGGATGGTTCTGATGACATAGGCTCTCAGATTTGGGATAGATTCTTTTATTAAAAGGGGAGGAGTTTAAGGGGAAGATCTGTGTCCCTCCGTGGCTGCCTGATTCCTTCTTCATAGCTTCTCGCCCGTTGGCTTTGGGGTTCAAGTAGGGGCCCCAGTGAATTTCTCAAGAGTTAGAGAGATACAAAGCTAACAAGGATCCAAAAGCATTCGCCCTGGTTCTCTAGCATGTGGAGGTTGGCAGGATGGAGAACAGTGCCAGTTTGGGGGAAAAGGAAGGATATCTTGTCATGTTGGGAAAAGATCTGGTCACTTCCTTCCTGTCCCGTATTTGGTTCTTTCTATCATGGTGTCTGTGGGAAAGGCCAGGCCGGATTACGGCTCCTATGCTGATTCTGCGTAACATTTCACCAGCCAGGCCTTGAGACCGAGGTAGCAAATATGCCTCTGCAAACTGATCAAAGGTCGCAACCTGTAGGCCTCTTGGGGAGATAGACAATGCCTGGAATGACTGTGGCTCTAAGGAGACCTCTGAGAAGCACTGGGCTGGTTCAGAGGTTCCTTCTTGAGGTCCATCCACATTGTGTTACTCTAGCTTTTTAGGGCAACTTCAGAATCCAATACCTTGCCTCGGCTTGTTCTTGCCACTAGACATCTATGTCAAAGGCCACAGAGCCATGCATCTGCAAAGGACATCTTCTTCCCATCTTTCTACTGGTTTCTAAATGCTGTCAGGTAATTCAGATTCTGGGGCTGAGAAGAGAGAAGAGGAATACCGGCCACTCAGCATGACTTTGAACAAGTTATACCAAAGAGATGATAAACTCTTTACTTCAGTGACACACTGGTTTTCCTAAGCTGCACAAAAGGCTAGAAACCATGCCTCTGATGACTGGACAAAATCCAGTGGGAAACATGCTGTCATAAGCGGGGGGAGAAGCAGCAATGCTTACGAAGGAGGCACAGAAATATGCTTTGCATCGTAAGACAGGATACGGGTTTAATCTAGACACAAGGTTCTTTTTCCCCCCTTTGGTAAGGAAAGTTGGCAGAAAGTTCATTTAAACCACTTCCAAGATTTATCCTTTTTGACAATATGCTGGAGAAACTTTGAAAAATAAGTTCGAGCTGATACATATATACGTATTTTTTGATAATGTAAATAAAAGTCACATATTAATCCACCCTGTACTGCTTTAAGTGAATATACTTTGGAAAAACATTTGTTAGCTAAGAGAGATGGCTTTAAAAACAAAAACAAAACAGGAATGTAAATGTCTATTTTACTAGAAATGACAAGTTTTTTTATTTTTCTTTAATGAAAAACGAAATTTAAGATAGGCTGATGACAAAGTATTTGTCTTGAGTAATGGGCATTTTTAAGTATGATCCTCATCCTTCCCCGGCAAAGTCCCAGCCTATTATAGTAAGGGTTGGAGTCAGTATACACTCATTGGAAAGTGACATTCTAGTCATAGGGAGAGGGTGTTAGAGACCTAGTCCAATATTTTTCTTTAAAGAGAAAACCTGAAGCCCAGAAAGATAAGTGACTTGGCCAAAATCATGTGGTTAGCGACAGAAACCGGATTAAAACATGTGCTGGAAGACTGTCCAGTGTCGTGTGCCTCAGAACCAAATTAAAGACAGGCACCAGAATGACACAGAGGGCTGAATTCCCTTCTCAAATCCTATCTTGCAGCAAGGCTAGGGAGGGCATGAAGACAAAAACAGAAACCTTACTGGTCTTCCACATTCTGAGTTATTTAGGTCTAAGACTTAAATGAACAATTCTGTTGGGGGAAAAAGAAAGTTTTGAATGAGCTTTTATATGATCTGCTACTAGCAGGACTAAGGATCCAGAGGAACAAGACAGGGGAAGGCAGAGGGACAAGAGTAAAGCAAAGGCATCTCTTTCATCATTGTCACCAGCTGATTCACTGAGGTTTGGTGAAAACCCAACACTGGGTGAAAGAAGGCGATTATCACTTGATGTGGGTCTTTTCTGTTATTCGTGAATTTTAAGCAGTTTGCCCAGGAGACTGGGG