Transcript asmbl_10192

Sequence
Transcript Sequence for observation asmbl_10192 of TGE0003546:
AAGTGGACGCGCTGAAAGGATCTGTGAGTATCACGCCACCATAAAAGAGGGAAAGTTACCCTATTGGATCTGTTCAGTTGACCAAGCTCATGGCGACATCTGAGCAAAACTTCAGATGAATATTTTCATCCAAAGAAAATAAATTGTCAAGACACGTTCAAAAGCACTTGAGATCTGAAGGTTGTTAGCTTGTGTATATTATGCTTCCAATAAGAAAAAAATACTTGTGTTCTCCGCCTAAAATCGGAGTGTTTGCCATTTGCCACTAAGGAAAATGGTTGCAAACGTTCAGTAAACTGTTCTGGGAATAGCTGGGCTTTTCTGACACTTGACCTGAGAAGTCTTTCTCATCTCCTGTAGAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTG