Transcript asmbl_10188

Sequence
Transcript Sequence for observation asmbl_10188 of TGE0003543:
CGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTATGGAACAAGGACTTGGGTGCATCTATTAATAGCTGCCATTTGCTAGGTATTATGCCACTTGCTTTACATACCTTATCTTATTTCATCTTCAGAACTTTTCTTCAAGGTAGCTGCTTACTGCTTTTTGTAAATAAGGAACCTTAGATTGAGAGAGATTGAGTGACTTGCCCTAGTCAGTTAATAGCAGAGCTGGGATTTGAACCTACGATTCTGTGAAAGCCAATGCTCCTCCCACTCTATGATACCTCCAGCTCAAGCCCCTGGGGAGAAAAGGCTTGGAGTAGAAAATTTAAATGTACTAATGAGACCAATCAGGGTAAACGCTTCTGAAGCAAATCCCTCACTTATGAATTACAAGAGTAAATTTTATGTGATGAGAACGAGAAGTGTACGAATGTGTTCCTTGTTCTTCGAGTGGTTTTCTCAGAACTTTACTGTTTTTCTTTACCTTTTTTAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGGTAAGTATTTGATTGCTCTTTAGGAAAAATTTTAGGAGCTTGTAACTATTCCGTTTCTAAAGCACACATTTTTAAATGATACTTGAAAAATGCCAAGGGAAAATTCGATAAAACATCTATAATTTTGAAACCTAAGTACTGTCTTACCTTCTCTGCAAACTC