Transcript asmbl_10145

Sequence
Transcript Sequence for observation asmbl_10145 of TGE0003531:
GCGGTAAACTGGAAAGATGTCCCTGTATGATGACCTGGGAGTGGAGACCAGCGACTCGAAGACGGAAGGCTGGTCCAAGAACTTCAAGCTGCTGCAGTCTCAGCTTCAGGTGAAGAAGGCGGCCCTCACCCAGGCGAAGAGCCAGAGGACAAAACAAAGCACAGTCCTCGCCCCGGTAATCGACCTAAAGCGAGGCGGCTCTTCAGACGACCGGCAGGTCGTGGACACCCCGCCGCACGTAGCCGCCGGCCTCAAGGATCCTGTACCCAGTGGATTTTCCGCGGGAGAAGTTCTGATTCCCTTAGCCGACGAATACGACCCTATGTTCCCTAACGATTATGAGAAAGTCGTGAAACGCCAGAGAGAGGAGCGACAGAGACAGCGAGAGCTGGAAAGACAGAAAGAAATAGAAGAGAGAGAAAAGAGGCGTAAAGACCGACACGAGGCCAGTGGGTTTTCAAGGCGACCAGACCCAGATTCTGATGAAGATGAAGATTACGAGCGAGAGAGGAGGAAAAGAAGTATGGGCGGAGCCGCCATCGCCCCACCCACCTCTCTCGTGGAGAAAGACAAAGAGTTACCCCGAGAATTTCCTTACGAAGAGGACTCCCGACCGCGCTCACAGTCTTCCAAAGCCGCCGTTCCTCCGCCGGTGTACGAGGAGCAGGACAGGCCCCGGTCCCCAACGGGGCCTGGCAACTCCTTCCTCGCCAACATGGGGGGCACGGTCGCTCATAAAATCATGCAGAAGTACGGCTTCCGGGAAGGCCAGGGGCTCGGGAAGCACGAGCAAGGGCTGAGCACGGCGTTGTCGGTGGAGAAGACGAGCAAGCGAGGAGGCAAGATCATTGTGGGCGAAGTCACAGAGAAAGATGCATCCAAGAAGTCGGATTCAAATCCACTAACTGAAATACTTAAGTGTCCTACTAAAGTGGTCCTACTAAGGAACATGGTTGGTGCAGGAGAGGTAGATGAAGACTTGGAGGTTGAAACCAAGGAAGAGTGTGAAAAATATGGCAAAGTTGGAAAATGTGTGATATTCGAAATCCCTGGTGCCCCTGACGATGAAGCAGTGCGGATATTTTTAGAATTCGAGAGGGTCGAATCAGCAATTAAAGCTGTCGTAGATCTGAATGGGAGGTATTTCGGTGGCCGGGTGGTAAAAGCATGTTTCTACAATTTGGATAAGTTCAGAGTCTTGGATTTGGCGGAACAAGTTTGATTTTAAGAACTGGAGCACGAACCACAAGCTCCAAGCCGAGCAGAGGAGGCGACAGCCAGCTCGCGTGCTGTGTGCGCAGGGACTCAGAAGGGCTGCTGAGATGTGTGTTGATTGGTCCCTTTTTTTTTATTTTGTGTTTTTTTAATATAGCATAAAAATCCTT