Transcript asmbl_9757

Sequence
Transcript Sequence for observation asmbl_9757 of TGE0002306:
CAGCCGGTTCCGGTCCCTGCCTTTCACTTCCGGTCGCCTTCCGCTCTGCTGCGGTCGGTTCCTGCGTCCGCTGCTGCCGGTTCCGCCACGCTGCAGGTATTTTTTCCTGAACAAAAGCTGCCTCAACCTATGTTTCAAGGATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAATATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTAGATCTCAAACAGTTTCTCAAGACGCTCACAGGAGTGCTACCAGAACGCCAAAAGTTGCTTGGACTTAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAGGATGTCTTAGGTCCACCTCCTGACAATGATGATGTTGTCAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTAAAAATTTCTCGCAGAGTAAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTAGTACTTGATGTGGATTATACATTATTTGACCATAGGTCTTGTGCAGAGACTGGCGTAGAATTAATGCGGCCATATCTTCATGAATTCCTAACATCTGCATATGAGGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAAATTACCTTCATGTTGGACAGTGCTGCTATGATAACAGTGCATACACCAAGGAGAGGATTAATAGATGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAATTTTACAGCAAAAAAAACACCATTATGTTTGATGACATAGGAAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCATCTAAATCGAGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAAATAGCAAAATTGGATGACTTTTTGGACCTAAATCACAAATATTGGGAAAGGTATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTGAGATCCATGAACTTCTTGCTTTAATGCTAGAAATCATTATAATAGTGCTGGACACTGAAGCAAATACCAGACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGCTCATGGCAATATGCTAAAAAACAAAAACAAACAAACAAAAAACCCTTTTTTCCCCGGTAAGAATATACTGTTACTCTTGAAAAATATTTTCTCCAGCATTGAGTACTGAGTTTTTTTTCCCACATACACAAAAAAAAGTGGACAAAAATGTATATTCAACAATGTCATTTTGTGACTTTGGAAACAAGTTATGTCTTGTGTTTTTGCCTCCTTGTGGTGTTTGACTAAATCTTAGACCAAACCCATCTTGAAAACTACTGCTCTTCCTTTTAAAACCAAAAAATATCTTTTGAGTAAGGAACCTAGTTTGGTGTTTAAGTTAAAGTCACCAAGAGTTTTTTTCATTCCTTTGTCATAGACACAGTTTCTCTTCTTGCTCCACTATTTACATATCTAAATTCTGAGCTGTCTCAGTTTGGTCTGTATGTGTATCCATGTTCTTTGAGTAAAACTGGAAAATGTCAGCCGTGATACAGATATGTCATAGTATGAAAATTAGAAAACAAGACTGAAGAATAAAATTAAGGAACGAGAGTTTCTTTTTGGTGACTAAGTAGAAGCACTTCTGCCTAAAACCATTGTCATAAAAGCAGTTAAAGGCAATACATTTTTAAATGGGACAAATCATCGATTAAGCCCTAGAAAGCATGAACAAAAAGGTTTTGTTCTGTTCCAGCTATACCTTGTCTAAGTGCAAACACTGTTTCAGTGGAAATATCTAGCCATAAGCTTTAAAAAATTATTTGCAATGCTTAAGCCTGCAGATGTGTAATGTGGCCACTGTTTTGTGTTAACAGTATTGCTTTATACAGTTCTTGTATTTGAAAGGAATCTGATCCTTTCACAGGAACATGGTATATATCGTTCTTACGGGACTATTTCAGTGGTGTAAATAATAAATACCTTTTCTTAAAATA