Transcript asmbl_9526

Sequence
Transcript Sequence for observation asmbl_9526 of TGE0007832:
ATAGATAGTAAACTATCTTTTTGAGGGCGAATCTTAATCTCCTTGGAAACGCTAAAGACGGCGTCTTCCGGGAAGCCTCGCCCCGTGACCTCAGACGTACACTTCCAGGGCACGAACGTGACCCGTCGCCCCGCCCTTTCCCACTCTCTCTTTCCGGTGGCGGAGTCTGGAGAAGGCACGCAGAAATGGCACCTCGCAAGGGGAAGGAAAAGAAGGAAGAACAAGTCATCAGCCTTGGACCTCAGGTGGCTGAAGGAGAAAATGTATTTGGTGTCTGCCACATCTTCGCATCCTTCAATGACACTTTTGTCCATGTCACCGATCTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCTGACCGAGATGAGTCCGCTCCATATGCTGCCATGTTGGCTTCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGCATCACTGCCCTCCACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCCGGACCAGGGGCCCAGTCAGCTCTTAGAGCCCTCGCCCGCTCAGGGATGAAGATTGGACGGATTGAGGATGTCACCCCCATCCCCTCTGACAGCACCCGCAGGAAAGGGGGTCGCCGTGGTCGCCGTCTGTGAACAGGACTCCTCAAATTGTTTTCTGTTAATAAATTGCCTTTGTGTGA