Transcript asmbl_9515

Sequence
Transcript Sequence for observation asmbl_9515 of TGE0029164:
TGACGAGGTGACGCTGGGAGCGTGGGCCGCGACTCTCGCGGATCCGGTTCCGCCCTCCCTCTTGCTGCCGACCCTCCGGGGCTAGCGCCCGAGTTCCCTTTCCCAGAGTCCTCTGCGCCGTGAAGAAGCGGCTCCCGGGGACCGGGGGCATTTTGCGTTGGCTGGAGCCGGAGTAACAAGATGGCGGCGTCGGCGGAGTGACAGGGGTCCCTCCGGGAGGGAGCCGGCAGCAGTGGTGGCAGCGGGATCGCCGCCCTAACTCACCGCGCCCCTTTTCCAGCCCGCGACGTCGCCGCGAAAGCGAGGCAGCAGCGGCCGCCCAGACACAAGTGGCCCAGCCTGGTAACCGCGAGGACCCCTCACACACTGCGGCCTGGCGAGAAGAAACCTGCCTGAGCGGCGGTGATCAGGTTCCCCTCGGCTGATTCCGGGCCTGGTAACGCCGAGCCAACGCTTTCAGCTTCCTGCCGCCCTCCTCCGCAGCCTTGCTCCGGGGACGAGCCCAGAGGCCTCCGTCCTCCTCTCAGAGGTGTCGGGGCTCGGCCCCAGCCCCCGTCTGCGCCTCTCAGGATGGCGAGCAGCAGCGGCTCCAAAGCCGAATTCATTGTCGGAGGGAAATATAAACTGGTACGGAAGATCGGGTCTGGCTCCTTCGGGGACATTTACCTGGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGAAAATGGCGGAACGACGTGACTCAACCGCAGATTCCTGCCCTTTTCTCTGCTTGGTTCACAAGTCAAGCTTCCTTGATTCCCCCCTTGGTATCCCTGAGTGGATTAAACCTTTGAAAAGCCAAGAATAAAGCTGCAGGCGGCGGTGGGGTTCAAGGAAGGAGAAGGCATAATGACAGTCTGTTCGCGAACTCTGCAGCAGATGCGACGTGAAATTATTAAATTATACTATGCAGAATCCTTCAGAGCCTTTTTAAAGGTGTTAATTACCCTTTCTGAATGGTAACGTTGGCAACATTTCAGTTTGTACTAAATTATGGGTAATGGTAAAGGCAGTTTGAGCGCAGCACTAGGCTGGCATTTCCTCAGATCGGTTGTATTAAAAGAAAGCTTAATCGCGTAATCACTGTTTGATGAGTAACTTTAACCTGTTGAGTTACTTGGTCAGTAACTCATCAGGGGAATTTTGGCCTTTGGGGGGCTGAGGAAGGGATATTGGTGAAGACAAGTAGTAGCAATAATAGTAACCAATAAAAGATAACCAAATAGAGACATTTGGTTTTTAAACGGTTGACTTTAAAGGGTTTTAAAATAGTTTGGAGTTTGAGATTAAACAGTCTTTTCCTATAATACAGACTAAAATATGGCATAAAACCCAGCGATATTACAACAGCATTTGCAAGAAGATTCAGAGATAGTTGAAAATTAAGTGAAATGATATTTACTGCAGCCTCTTTCTGTTTCAATTTCTGTTCCTCAAATCTTGAATTAAGAACTAGATGACATATGTTAATTCTGATGTGGAAACAACCAAAGTAACACCATCC