Transcript asmbl_9513

Sequence
Transcript Sequence for observation asmbl_9513 of TGE0029162:
CACAGGGACGTTGATGCCATTATCCCCTCTTTCCCCTGCAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTCTATAAAATTCTTCAGGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGTCAGGAAAAAGACTACAATGTGCTAGTCATGGATCTTCTTGGACCCAGCCTTGAAGACCTCTTCAATTTCTGTTCGAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGGAAGAGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAGTACAGAGACAACAGGACAAGG