Transcript asmbl_22045

Sequence
Transcript Sequence for observation asmbl_22045 of TGE0004220:
GCATGCGCGAGTGTACGCGTTGCCGGCGAAGAGGGGAGCCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCGTGGAGACTGACATCTTGGAGTCGTTGGAAGATCTAGGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGAT