Transcript asmbl_17330

Sequence
Transcript Sequence for observation asmbl_17330 of TGE0000429:
CACACAGGCTGCTGGAAAGGGATAAACAGCACTTCCAGGGGGAGAAAAAAAATCATGTTATCAGAAAGCAAAGAAGGTGAGGAGAAGGAGGAAGTGACCATGGACACAAGTGAAAACAGACCTGAAAATGATGTTCCAGAACCTCCCATGCCTATTGCAGACCAAGTCAGCAATGATGACCGCCCGGAGGGCAGTGTTGAAGATGAGGAGAAGAAAGAGAGCTCGCTGCCCAAATCATTCAAGAGGAAGATCTCCGTTGTCTCAGCTACCAAGGGGGTGCCAGCTGGAAACAGTGACACAGAGGGGGGCCAGCCTGGTCGGAAACGACGCTGGGGAGCCAGCACAGCCACCACACAGAAGAAACCTTCCATCAGTATCACCACTGAATCACTAAAGAGCCTCATCCCCGACATCAAACCCCTGGCGGGGCAGGAGGCTGTTGTGGATCTTCATGCTGATGACTCTCGCATCTCTGAGGATGAGACAGAGCGTAATGGCGATGATGGGACCCATGACAAGGGGCTGAAAATATGCCGGACAGTCACTCAGGTAGTACCTGCAGAGGGCCAGGAGAATGGGCAGAGGGAAGAAGAGGAAGAAGAGAAGGAACCTGAAGCAGAACCTCCTGTACCTCCCCAGGTGTCAGTAGAGGTGGCCTTGCCCCCACCTGCAGAGCATGAAGTAAAGAAAGTGACTTTAGGAGATACCTTAACTCGACGTTCCATTAGCCAGCAGAAGTCCGGAGTTTCCATTACCATTGATGACCCAGTCCGAACTGCCCAGGTGCCCTCCCCACCCCGGGGCAAGATTAGCAACATTGTCCATATCTCCAATTTGGTCCGTCCTTTCACTTTAGGCCAGCTAAAGGAGTTGTTGGGGCGCACAGGAACCTTGGTGGAAGAGGCCTTCTGGATTGACAAGATCAAATCTCATTGCTTTGTAACGTACTCAACAGTAGAGGAAGCTGTTGCCACCCGCACAGCTCTGCACGGGGTCAAATGGCCCCAGTCCAATCCCAAATTCCTTTGTGCTGACTATGCCGAGCAAGATGAGCTGGATTATCACCGAGGCCTCTTGGTGGACCGTCCCTCTGAAACTAAGACAGAGGAGCAGGGAATACCACGGCCCCTGCACCCCCCACCCCCACCCCCGGTCCAGCCACCACAGCACCCCCGGGCAGAGCAGCGGGAGCAGGAACGGGCAGTGCGGGAACAGTGGGCAGAACGGGAACGGGAAATGGAGCGGCGGGAGCGGACTCGATCAGAGCGTGAATGGGATCGGGACAAAGTTCGAGAAGGGCCCCGTTCCCGATCAAGGTCCCGTGACCGCCGCCGCAAGGAACGTGCGAAGTCTAAAGAAAAGAAGAGTGAGAAGAAAGAGAAAGCCCAGGAGGAACCACCTGCCAAGCTGCTGGATGACCTTTTCCGAAAGACCAAGGCAGCTCCCTGCATCTATTGGCTCCCACTGACTGACAGCCAGATCGTTCAGAAAGAGGCAGAGCGGGCCGAACGGGCCAAGGAGCGGGAGAAGCGGCGAAAGGAGCAAGAAGAAGAAGAGCAAAAGGAGCGGGAGAAGGAAGCCGAGCGGGAACGGAACCGACAGCTGGAGCGAGAGAAACGTCGGGAGCACAGTCGGGAGAGGGACAGGGAGAGAGAGAGAGAAAGGGAGCGGGACAGGGGGGACCGAGATCGGGATAGGGAAAGGGACCGAGAACGAGGCAGGGAAAGGGATCGCAGGGACACCAAGCGCCACAGCAGAAGCCGGAGTCGGAGCACACCTGTGCGGGACCGGGGTGGGCGCCGCTAGCTGGGAAAACACTAGAGCTGCAGGTACCAGCCACTCGGCCCCAGGGGGTTATGGCCACAGAGGGATAGGCACAGTCTCCACCACCCTGGAGCCAAGGGTCTTTCACATCACCTATCCCTACATACATACCAAATGGAAAAGTGGCCATCCTTTTCCCCCCAAACACACCCCCTTAACCTATCTCTTGGGACTTAGCCCGACCCTCCCTCTCATTTCCCATTAAGTCTGAGAGGCAAGAGCTAGGTTAGGCAAGGAGGTGGTTGGCCAGAGATGGGGAACAGCCAGGTGCCCCAGTCCTCTGATTTTTCCTCCATCCTGCTTACCACCTCCCTGGGTACTTACAGCCTTCTCTTGGGAACAGCCGGGGCCAGGACTGGGTCACCTATGAGCTGAATCAGCATCTCCTCCTGAGTCCCAGGGCCCCTGCAGTTCCCAGTCTCTTCTGTCCTGCAGCCCTTGCCTCTTTCCCACAGGTTCCACTTTATATCCACC