Transcript asmbl_21972

Sequence
Transcript Sequence for observation asmbl_21972 of TGE0004210:
GTCCGGGGGAAGCCGTGCGAGAACCGTCACGTTAGAGCCCGGTTTCTTCTTGGCGGACAGAAATGGACTCAGAAATCAAGGAGGAAATTCCCGTGCATGACGAATACGTTTTATGTGGCGGAGCTGAAACCTGCGTTCTGAAGTGTGGGCCCTGGACTGACCTGTTTAATGATCAGAGCGCCAGCAGACCTAAGCTGCTCATTTTCATTATTCCTGGTAACCCAGGTTTGCCTGCCTTTTATGTACCATTTGCAAAGGCTTTGTACTCTTCAGTAAACAGACGCTTTCCAGTGTGGGTTATCAGTCATGCTGGGCATGTTTTGGCTCCCCAAGACAAGAAGATTCTTACAACCTCGGATGATCCAAATGCTCAAGAAATTAAGGACATCTACGGACTCCGTGGTCAAATAGAACACAAGATAACTTTCCTGAGAACTCATGTGCCAAAGGAAACGAAACTGGTGGTCATTGGCCATTCAGTAGGCTCCTATATTTCCCTTCAGATTTTGAAGCATGCCCCCGAGCTCCCAATAATTCGCTCCTTCCTGCTCTTTCCAACAATTGAGAGACTATCTGAGTCACCCAACGGCAGAATCGCCACTCCGTTATTATGCTGGTTTCGATATGTTTTAAATGTTTTTAGCTACTTGTTATTTAAACCATGTCCGGAGAAAATCAAGTCCTGGTTGCTCAGGACGAGCTGTCAGATAATGAACCTGCAGGATGAATGTTCAGTCCAGAATGTGTTGGAACCTTTCTGCCTTGTTAATATTGCCTATCTCGGTGGCCAAGAAATGATGGAGATAGTAAAGAGAGACAACGAAACCATAAAGGAACATTTGTCTAAGCTTACATTCTACTATGGTGCTAAAGATGCTTGGTGTCCAAAAGAGTACTATGAAGACATAAAGAAAGACTTCCCAGAAGGAGATATTCGACTCTGTGAGAAAAAAATACCTCATGCTTTTATCTTATACTCTTACCAAGAAATGGCCGACATGGTGGCAGACTGGCTTAAGGACGATCTGTCCAAAATTGAAACGGTGACAGAAGAAAACCAGGACTGATAGCTGGCACGTAGAGGCGATAAGTATACTGCCTCTTTGTAGCAAGTAGTGCACTTAGTAGGTAAATGTTTAATTTTGATGTTTAATAATCGGAGAGAAAAAAAGTGAGAACCTCTCGGCTTACAGTCTGCCCACTCCCAGTTCCCCGTGCTACAGTCTGTGGTAAACACGGTTGATGGAATATTCCATAAATTTAACCTCACCTTTTCCAGGACTCACAACATGGAGATCTAGATAGGTCTCTTCCGTTTGCACGAGACGCCCAGTGGCACAGCTTATTTTGGTAGGCAGGATCGTTGCAGACAAAAGGAAGTCTAAATTTAGTTTATTTTAACTGATTTACCTTATAGAATGGCTTCTCCTAGAGGAAATTATTAAATAACTACTAGAAAATGTAAAAGAGATCAGTGAATGTTAAGTGTATAATCAGATATGTGAAGTGTATGAGATCGTGAGAAGGACATACTCATGTACCAACAGCAGGAAGTGATGAGCCATGGATCTTGGCAGCGGACCTGGGTCTCTCTTAAGGACAGAAGTTGAAGATTAGCCCAGACTAACTTCGTAAAGGCCTTGCCTGAGATCATCAGAATCAGGCTGAATACCAGGGCAGCCTGCGCCCACCTGTTCCTACCTTGCAGTACGTCGCAGACCACCAAGTCGGCCTTTTGTCTGAACACCAGTGGCACGAGCCCAAGGAGAGCCAACATTGGGGGAGGTGCTGCTCATCCTCACCTCTGAGAAGCATCCCTGAGGAGTGTGACTCCCTCATCCACCTGCCTTAGACAGGGAATGAGGTTTGACAGCCTTTGCCCTAGTCAACTAACCAGAGAAGAGTCGTTCAAGGATCCTGACTCTGCCTCCCCACCACAAGGCAGCCAGCCAACTCTGTGCCGAGCCTTAGTCTGCCGGACTGTGAGCTCCCTGCATGCTCCTCTTCTCCAGAGCCAGATGCGGAGTCCCTGGACTGTCCCAAATCAATCCTGTATGTACCCACCACATGCAGTTCCTCTTCT