Transcript asmbl_8279

Sequence
Transcript Sequence for observation asmbl_8279 of TGE0007464:
CGGTCAAGCGGAATCGTCTTTGCTGAGGGTCACATTGAGCTGCGAGCTGTTTCAGGGGCGTCTTTAGAATGCCTGCCAGCACTCTTTGCCTCCAGGAGTCAGCAACATGGCAGAAGACATCAAGACCAAAATCAAGAACTACCAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACCGCTAAAGGGGGTGATGTCTCCGTATGTGAATGGTACCGGCGTGTGTACAAGTCCCTCTGCCCCATATCCTGGGTGTCAACCTGGGATGACCGCCGGGCAGAAGGCACATTTCCTGGGAAGATCTGAACTGGCTTCACTCCACCTCTCCTCTGTCTTCCATCCCTCTCCCAGGGAAGCGAGGGTGGACCTGGGTACATCCCACCCTGGGATCCTAAATCGTGGTTTAACTAATAATAAATACTTGTTGGAAAAGTATAAGACTATGTGTGAAAGAGCTGGATGATGAGCAAGAAGCTAGGTTGGAAATAGTGCCTAGACCAGTAAGAGGGGCTTCAGAGTGATTATTTTTTTGTTTCATTTTGTTTTTAATTTTTATTTTATCAAACTTTGACCACTTCCTCTGTGCCAGACAGTAGAGTGAGTGATTATATGAAATAGACTCAAGCCCCTATATATGCTAAAATTT