Transcript asmbl_21386

Sequence
Transcript Sequence for observation asmbl_21386 of TGE0004203:
CCGAGCCCTGCCTGCCGCAGGTTTCCAATAGCTTCTGCACACCGGAACTCAGGTGGAGCAGAGACCCAGAAGTCCTGCGCTGTTTGGTGAGCGTGTACGCATAGCGCAATCTCGCGTGCTGGCCCGGGGCGAACAGAGCTGCCAGATACTTTGTTGTAAGAAATTGAACATGGCAGAAGAAGAGGACTATATGTCTGATTCCTTCATTAACGTCCAAGAAGATATCAGACCGGGATTGCCAATGCTGAGGCAAATTCGAGAAGCTCGTCGAAAAGAAGAAAAGCAGCAGGAAGCTAATTTGAAAAATAGGCAGAAGAGTTTAAAAGAAGAAGAACAAGAAAGACGTGACATTGGGTTGAAGAATGCACTAGGCTGTGAAAACAAAGGGTTTGCTTTGCTCCAAAAGATGGGATATAAAAGTGGCCAGGCCCTTGGCAAGAGTGGAGATGGTATTGTTGAACCAATTCCTCTCAATGTCAAAACAGGGAAAAGTGGCATTGGTCATGAGGCATTGTTAAAACGGAAAGCAGAGGAAAAATTAGAAAGCTACAGAAGAAAGATTAATGTGAAAAAGCAAACTGAAGAAAAAGCTGCAGAACAGTTTCGAATGCGACTTAAAAATAAGCAAGATGAAATGAAGCTAGAAGGAGATCTTAGAAGAAGCCAGCGAGCCTGTCAACAATTGGATACTCAGAAGAATATTCAGGTTCCCAGGGAGGCCTGGTACTGGTTGAGGCTTGAAGAAGAGACTGAAGAAGAGGAAGAGGAAGAAAAAGAACAAGATGAAGATGAATATAAGAGTGAAGATTTAAGTGTACTGGACAAATTACAAATATTGACTAGTTATTTAAGAGAAGAACATCTGTATTGTATTTGGTGTGGAACAGCCTATGAAGATGAAGAAGACCTGTCTTCACATTGCCCAGGACCAACTTCCGCAGATCACGACTAAGAGTAGTCTCAATAAAGTAGAAATCTGGAAAATGCTGTTATTCTCAAAGACAGATAGTTGAGCAGTTAGAATTCCCAGATTTTGGACACCAGTAAAGAAAGAGGGCCTTATATATTTTGTTCTTTTTCTACTTTCGAAGTCCTTCATACTTTAGAATTGTTCACTGACCTCCAAAAATATAATGGAATGCTATTTCAGAACATGAGTTATAGACACGGGCCATTACAATTTATGACTCTGTTGTGATACTTATGGAGTTTAAGGGACACCAGCAGGTAACTCCCTTATTCCTCTCTTCACTTCAGAACAAATTGAAAAATAAGACATGGGAGCCAGCTTTATTATCAGTGAAGCTGAAATAGACGGCAAGGCTGATTTGTTCTCTAGTCAGACTCCCTAACATAGCTCTGTGATTGGAGAGACTGCAGACCTCGGTGAGAACACAGCCCATTTCACATTTTCAGACTAGTTAGCTTTCAAGGTGACAGAATCTACTAGGGGCTGGGCCACACAGGCTAGGTTCCTTCTCTCAATAGCACTCATCAGATAAGACATCTCTCTGTTGAAAGAGAATCAATGAGGGTTCACAGAGCTTGTTCC