Transcript asmbl_17323

Sequence
Transcript Sequence for observation asmbl_17323 of TGE0000427:
CCGGAATAGATTTAATAGGAAGTGAAGCTGTGACGGCGAGGCGTTGCCCGGCCTATCTTTGCTAGGCGTTCTCAGAATTAGTTCTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCTGGATCTAGGTCCAGGGAGTCTCAGTGATGGTCTGAGCCTGGCCGCGCCAGGCTGGGGTGTCCCAGAAGAGCCAGGAATCGAAATGCTTCATGGAACAACCACCCTGGCCTTCAAGTTCCGCCATGGAGTCATAGTTGCAGCTGACTCCAGGGCTACAGCGGGTGCTTACATTGCCTCCCAGACGGTGAAGAAGGTGATAGAGATCAACCCATACCTGCTAGGCACCATGGCTGGGGGCGCAGCGGATTGCAGCTTCTGGGAACGGCTGTTGGCTCGGCAATGTCGAATCTATGAGCTTCGAAATAAGGAACGCATCTCTGTAGCAGCTGCCTCCAAACTGCTTGCCAACATGGTGTATCAGTACAAAGGCATGGGGCTGTCCATGGGCACCATGATCTGTGGCTGGGATAAGAGAGGCCCTGGCCTCTACTACGTGGACAGTGAAGGGAACCGGATTTCAGGGGCCACCTTCTCTGTAGGTTCTGGCTCTGTGTATGCATATGGGGTCATGGATCGGGGCTATTCCTATGACCTGGAAGTGGAGCAGGCCTATGATCTGGCCCGTCGAGCCATCTACCAAGCCACCTACAGAGATGCCTACTCAGGAGGTGCAGTCAACCTCTACCACGTGCGGGAGGATGGCTGGATCCGAGTCTCCAGTGACAATGTGGCTGATCTACATGAGAAGTATAGTGGCTCTACCCCCTGAAAGAGGGTGGATGCAGCTGCTTGTGTTTCTTGGGGTGACTGTCATTGGTAATACGGACACAGTGACCCATCCTCCATCCTATTTATAGTGGAAGGGCCTTCAATTGTATCAGTACTTTTTTTTAAGCTCTGGCACATTGACCTCTATGTGTTACCAGTCATTAATGAGCTGCTGCAGAGGTGACTATTTGTTTTACTTTCTTGGATGTTAACATTACACTACTCACTACTCAATCTCA