Transcript asmbl_82005

Sequence
Transcript Sequence for observation asmbl_82005 of TGE0007664:
AGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGA