Transcript asmbl_82004

Sequence
Transcript Sequence for observation asmbl_82004 of TGE0007664:
AGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGA