Transcript asmbl_81037

Sequence
Transcript Sequence for observation asmbl_81037 of TGE0007598:
GGCGACGGAAGTGGCCCCTTTACTGTTTGTCCGTGCGCAGGCGTTATTCTATTCTCTTGCTGCTGCTCTTCAGGCGCTTCTTTTCCCTCTCTTCTCTCTTCTCCACGCGAGGGGGTGCGCGTACCCTTAGTCGTGGTCGCGCACTCAGCCCCTGTGCTACTCTCGTGGCACTTTCATCATGGCGGGCATCCTGTTTGAGGATATTTTTGATGTAAAAGACATTGACCCGGAGGGCAAGAAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGCGAATCTTTCAAGATGGACCTTATCTTAGATGTAAACATTCAGATTTACCCTGTAGACTTGGGTGACAAGTTCCGGTTGGTCATAGCCAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACAGATGACAGACCTTCCAGGGCTGACCAATTTGAGTATGTAATGTATGGGAAAGTGTACAGGATTGAGGGAGACGAAACTTCTACTGAAGCAGCAACACGTCTCTCTGCCTACGTCTCGTATGGGGGCCTGCTCATGAGGTTGCAGGGTGATGCCAATAACCTGCATGGATTTGAAGTGGATTCCAGAGTTTATCTGCTGATGAAGAAACTGGCCTTCTGAACCACCTGGGAAGCCAATCTTGCTGCTTAGTCACTTAGGTCATGGACATTCATTCAAGTCTGAGCAGCAGTTGCTGTTGTTCACCTGTCTAAGAGGGGCTGGATTTGTGTTGATTGTGCCGTGCATCTTTAGGTGGTGTCTGAACTCAATGGGAAGTTGACTTGCTTGTGAAAGACCCAGTGGGAGGGCTTAAAAGGAATAAGAAGTTGTTGTGTGTATATGATTTTTTAAATTAAACTTTACTTTCTCAGACTTTCTTCCCTTAAAATATATATTTTTTTCTGTTTACTTTAAAA