Transcript asmbl_78693

Sequence
Transcript Sequence for observation asmbl_78693 of TGE0007458:
GGTGATTCCGGAAGAAACCAGAGTGCGGCGTGAACATGGGAAAGCAAAAGAAAACAAGGAAGTATGCGACCATGAAGCGAATGCTTAGTCTCAGAGATCAGAGGCTTAAAGAAAAGGATAGATTAAAACCTAAAAAGAAAGAAAAGAAAGATCCCAGTGCACTCAAGGAAAGAGAAGTCCCCCAACACCCTTCTTGCCTATTCTTCCAATATAACACACAGCTGGGGCCCCCTTACCACATCCTGGTTGATACCAACTTTATCAACTTTTCCATTAAAGCCAAACTGGACTTAGTACAGTCAATGATGGACTGTCTGTATGCCAAGTGTATCCCTTGTATAACTGACTGTGTAATGGCTGAAATTGAGAAATTGGGGCAGAAGTATCGAGTGGCTCTAAGGATTGCCAAGGATCCAAGATTCGAACGATTACCATGCACACACAAAGGAACCTATGCAGATGACTGCTTAGTACAGAGAGTAACTCAGCACAAGTGTTACATTGTGGCCACGGTTGACCGAGACCTTAAACGAAGAATCAGAAAGATCCCTGGAGTTCCCATCATGTATATTTCTAACCATAGGTACAACATTGAGCGGATGCCCGATGATTATGGAGCCCCTAGGTTCTAATTCTTAAAAGATAAAATTCATCTGCTTTCCTTCAACCAACTTTCTCTGTTGCCAGTTTATTAAACATGCTACAGCATGAATTATTCTACTCAGACATTTGCTCTGTTATAAGCTGAGTATGGTTAAATACACTCAGTTTTTGATATTTGAAAATGATATTTTTGTATCATTTAAAAATTTGTTGCATTTTTTTATAGATCAGATGACTGCTCACAAATTTAATGGTTGTTTTATATTGATTTACTCAAATATTTATTAAGGTTATACTAGGTACTTAATAAGATAGGGTCCTCAAGACACTCATAGTGGGAAAGAGGAGCATGTAGGTGAATAAATATAGTAAAATAATAATGCTAAGATAAAAGTATGAGGAGTAGACACATAAAAAAGATGATTTTTTTCTATTCAGTTGGGGTGGGAAGGGAGGAAAAGCTAAAGGTAGCAATGTTTAAGTTCATCTTTTTTTAAAATTTATTGGGGTGACACTGGTTAATAAAATTATATAGGTTTCAAGTGTACAGTTTTATAATACATCATCTTTGAGTTAATCTTTAAAAATAAATAGGTGCTTGCCCAGTAAATGAGATAAAGGAAATGAGGCACAGGAAGCATCTGAACAAAGCATGGACATAGATATTACATGAAATGAATGTATCTGGTCTGTTCAGACAACTGCCAGAAGATTTTTATAACTAGAACATGGGAAAGAGGTCTATACTCATGTCTGAGACTCCAAAGGTAAG