Transcript asmbl_17312

Sequence
Transcript Sequence for observation asmbl_17312 of TGE0000424:
GGGGAAGGGGGAGAAGAAGAAGATCGGTAGATTGAGTGGCTAGAGAGGTCGGAGGTAAGTGGCTATAGAAGTCGGGCGGACCCGGAACCCAGAGGACGCGACACCATGACTTATGCTTATCTCTTCAAGTATATCATCATCGGAGACACAGGTGTGGGGAAGTCATGTCTCCTCCTGCAGTTTACAGATAAGCGGTTCCAGCCTGTCCACGACCTCACAATAGGTGTGGAGTTTGGAGCTCGTATGGTCAACATTGATGGAAAACAAATCAAACTGCAAATCTGGGATACGGCTGGGCAAGAATCCTTCCGTTCTATCACCCGTTCCTACTACAGGGGAGCAGCTGGAGCACTGCTGGTGTACGACATTACAAGGCGTGAAACCTTCAACCACCTGACCTCATGGTTAGAGGATGCCCGGCAGCACTCTAGTTCCAACATGGTTATCATGCTCATTGGGAATAAGAGTGACCTAGAGTCCCGCAGGGATGTGAAGAGAGAAGAAGGAGAGGCCTTTGCTAGGGAGCATGGACTTATATTCATGGAAACTTCAGCCAAAACAGCCTGCAATGTTGAAGAGGCCTTCATTAACACAGCCAAAGAAATATATAGGAAGATCCAGCAGGGTTTATTTGATGTCCACAATGAGGCAAATGGCATCAAGATTGGGCCCCAACAGTCAATTTCAACATCAGTGGGACCCAGTGCCTCCCAGCGGAACTCTCGTGACATAGGGTCCAACTCTGGCTGCTGCTGAACATCTGGCTTGAACTTTTTTTGTCCTTCCTGGAATAGCTTCAGATCAATAGGCTTAATGAAAGAGGTCTTTCTTGCTTTGGCTGAGAGCAGCCTCTTTTTAAAGTGTGATGTTTTGCCTTTCCACCTAAAGACCAGGAGAGAATTTGGGCCCTTACTGACCTGTCCTCCTTCAGGGACATGAGCATTCCCTATAGATTAGGGTTCTTCTTATCCTCCTATACAAATTTCTTAAATTGTTAGGATCAAAGTTGATTATCACAGTAGTTAAAAAATAATTTCATGGCGGGGCGCCATGGCTCATGCCTGTAATCCTAGC