Transcript asmbl_76541

Sequence
Transcript Sequence for observation asmbl_76541 of TGE0026027:
GCCGCGGCTGGGCGCGCAAGGTGGGGAGGTGCGGAGCTGGGCTTTGGGAGGCGGGGCGCGCGCGGGGGGGTACCCCTCCCTTCGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGGTGAGCACTGTTCACCCTCTCCCAGACTATACTCCTCCAGTGAATTTCTTACCTTTCTTGCTTCTGCCTGCCTGCTTCCAGGGCTTCCTTGAAGCAAAGAGAGTAAGGAAGGAGATAAGTAAGCAGGGGTGGGGTGGGATCCAGAGATTGAGAGAAATGGGGCCAGTAGAGAGCTATGCACAAAGCTAGAGCAGGTGGAGGTAAGGAAACCAATTTTGCTGATCACCAGGCCCCAAGCCTAACACTTTGCTTCTTTTATATGATATAGTTCTCACAACCTTCTGAGGTGGTAGATGCTGTTTTACAGAAAGGAAACACAGACTTAGAAAGTTTCAGTAACTTGCCTAAGGTCATATAGCTCAAAAGTAGCAGAAATGTCATTGAAAAATAAGGAGGAAAGGGAAGCAAAGATGAGGCTAGGACATTGAAAGAGTGGAGATGGGTGGGGAGGTAGAGACCCCTCACTCAGAATGGGGAAAGAGGAGGACAGAGAACCAACTCCCAAGCATCATATTCAGCTTTCTCCCAACCATGGCATCACCCCTGCTTGGCCCCAAACGCCCCTCTCTGCCTCCCTGGCCCTCATGGCAGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGACCTGTGCCCTGGACACATGTGGATACATGTGGGTCCCACTGTGCTTGTGCACCACAGATGGTTTATGGACATGTGTGTCCCAGCCTCTGCTAGAGCCAGGAGGAAAAGGCTCCCAATGTGGTGACACCTTTCTTGTTCACACTGGACCCATCTTGAGCCATAGTCACTGGATGGACTCTGCTCTCAAGATTAAAACTACTGACAGGGAACAGCCCACCAGGCTGTACCTCAAGCTGTAGTTCCTGGCACCCATGCCAGAGAGCGTGAGGTCTGCCTGAGGTTGTCTAAGGGGGTGTTTGTAGGACCCAGCATGCTCAGACACAGAGCAGAATGAACTAAAATGAGGGTCCCCAGGATGACTTTCTTTCATGGATCTCTGTGAAGCCTCTCTCCTCAGCCACAGCATGTCCTAGCAGGGAATGCGGCCTAAAGGAACAAAGATAGACATCCTGGCATGCTGTGCGGGGACTGCCCTGGGAGCACAGTGGAATCCTCAACAGAGGAGGGGACCGGCCCTGGGCCAAGGAGATGTTGGAAGGATACATAAGAAATACCACTTCTCACCCATCACTACCATCCCGGCCTCTGAAGGGCCTGGAGAATTCCCACAAGATCACAGAGGGAGCGACACTTGAATGTAGGACAGGGAGGAAGCCCTGTCCCTGTCCCATTGGCCAGACCCCACTCTGCCCCCACTGACCAAGGGTTAGGGGCCAAGAAGTGGAGTTCTTGGCTGTCCTTGGCTTTCATCACCTATCGGCTCTGCCTTCTCCCCCATGGGCTGAGTCCTGAGGCCCATTCTAGAAGTCGAAGCTGGTTCCAAAAACCCTCTCCTGCCCCCTGCCTGTTGGCAGCTCCCCTTACCCCCTTCCACGGTACTGTAGTAGGGGAGCTCCCTCTCCCTCCTTGTGCCTTCTTTGTATATAGGCTTCTCACATCAACTAATAAACAGCTCCCTGTTTGTACACTCTG