Transcript asmbl_76508

Sequence
Transcript Sequence for observation asmbl_76508 of TGE0028862:
AAATTATTCCTTCCCCCGGGTAGAATCCCGGGTTGAGAAACTGGTTCCGAATCCAAAGGAACCCGGTGTCGCCCGACGCCGGGTCACGTGGCTGGCGGTCCGATGACGTGCGGTCTGCGGGGCGTCACCGTGACGTTTGGGCGACCGGCCGAGTGGCCCCTCTACCTTCGTTACCTGTGCGGCCGCGGTGCAGTCATGGACCTGGGACCGATGCGCAAGAGTTACCGCGGGGACCGAGAGGCGTTTGAGGAGGCTCAGCTGACCTCCCTGGATCCCATGAAGCAATTTGCTACCTGGTTCGAAGAGGCTGTTCAGTGTCCTGACATAGGAGAAGCCAACGCCATGTGTCTGGCTACCTCCACCAGAGATGGGAAGCCCTCTGCCCGCATGGTGCTGCTGAAGGGCTTTGGCAAGGATGGCTTCCGCTTCTTCACTAACTTTGACAGTCGAAAGGGAAAAGAGCTGGACTCTAATCCCTTTGCTTCCCTTGTCTTCTACTGGGAGCCCCTAAACCGTCAGCCAGGGCCATCTCTGAG