Transcript asmbl_76439

Sequence
Transcript Sequence for observation asmbl_76439 of TGE0028856:
GACAAAAGCCGGATCCCGGGCGGTGGCGGGAGGGTGGCGCGCTCCGGGTAGTGGCCTGTGATTCAAGGCCTGTGGAGGGAGCGCCGCGCACAGACTTTCGCAGAGAGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGGAAGGAGCCACCTGGTGGAGGGAGGAGGTGAGAGGAATATAGCCTGCTGCTCTGGCCTGGCCCCTTGCCAGAGCCCCGGAGATAAGGGGAGGAGTGCCACCCTCTTCAGCCACCACACCAAGGCCATCGTGTGGGGCATGCAGACGCGGGCCGTGCAAGGCATGCTGGACTTTGACTACGTCTGCTCCAGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTATTGGGGTCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAAGAAACACCCTGAGGTAGATGTGCTGATCAACTTCGCCTCTCTCCGCTCCGCCTATGACAGTACCGTTGAGACCATGAGTTATGCACAGATCCGGACCATTGCCATCATAGCTGAAGGTATCCCTGAGGCCCTCACGAGGAAGCTGATCAAGAAGGCAGAGCAGAAGGGTGTGACCATCATTGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAAATCGGGAATACAGGTGGGATGCTGGACAACATCCTGGCTTCCAAACTGTACCGCCCTGGCAGCGTGGCCTACATCTCGCGTTCTGGGGGCATGTCCAACGAGCTCAACAATATCATCTCTCGAACCACGGATGGTGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCTGGTTCAACATTTATGGATCACGTGTTACGTTACCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATAGGGGGCACTGAGGAGTATAAGATCTGCCGGGGCATCAAGGAGGGCCGCCTCACCAAGCCTGTGGTCTGCTGGTGCATCGGGACCTGTGCTACCATGTTCTCTTCTGAGGTACAATTTGGCCATGCCGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAAGAGGCAGGAGTCTTTGTGCCCCGGAGCTTCGATGAACTTGGAGAAATCATCCAGTCTGTGTACGAGGATCTTGTGGCCAAAGGGGCCATTGTACCTGCTCAGGAGGTACCGCCCCCGACGGTGCCGATGGACTACTCCTGGGCCAGGGAGCTGGGCTTGATCCGCAAACCTGCCTCATTCATGACCAGCATCTGCGACGAGCGAGGACAGGAGCTCATCTACGCGGGTATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGTCTCCTCTGGTTCCAGAGAAGGTTGCCCAAGTACTCCTGCCAGTTCCTTGAGATGTGCCTGATGGTGACAGCCGATCATGGGCCAGCCGTGTCTGGCGCTCACAATACCATCATCTGTGCTCGGGCTGGGAAGGACCTGGTTTCCAGCCTCACCTCGGGGCTGCTCACTATTGGGGACCGGTTTGGGGGCGCCCTGGATGCAGCAGCCAAGATGTTCAGCAAAGCCTTCGACAGTGGCATTATTCCCATGGAGTTTGTAAACAAGATGAAGAAGGAAGGAAAACTGATCATGGGCATCGGTCACCGAGTGAAGTCGATAAATAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAAACAGCACTTCCCTGCCACCCCCCTGCTCGACTATGCGCTGGAAGTGGAGAAGATTACCACCTCAAAGAAACCGAATCTTATCCTGAATGTAGATGGCTTCATCGGAGCTGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAAGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGCTTCATTGGACACTATCTTGATCAGAAGAGACTGAAGCAGGGGCTGTATCGTCACCCATGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAACTGAGCCAGGAACTGTGTTGCAGTAAAGTGAAGACAAGATCTCCTCCCCCCAGAAATAGTGTGCAGACAGCTGGCACTGGAGCTTGCTATAGGATGGGCCTGGAATATAAACAGCCGTTGGTATACAGGCACCGAAGACCAATACTCACAGGCTAACACTGTTTAGTCCACACAATGAAGCTTAATATTTTTTTTATAAGCATAGAAATAAAAACCAAGCCAATATTTGTGACATCTGCTCTGCCACCTGCTGTGTTTATTATATAAAAGCATCTAAGCACTGTCAGGATGGCATTTTTCCTTATTATAGGGCGTTATAATGTTGCTTTCTTTTTTCCGTTAGTTAAAAATTTTCCCTTGGAGGAAGGGAATGAAACTTTTAAGACTTCAAGATATTATACATTTAAAGCATCCCTAATGTCTTGTTTTCCTGCTTATATAACCTGAAGAGCATTGTATTAATCTGATTTTTTTTTATGATCTTTTTGTATGTTATGCGTGAAGGATTTGTTCGGTATCTCACTGAAACATTTCATGTTGTAGACTAAAGTCTGCTTCTGTCAGGGGGATTGGACCATTGCATCCTTAGCCACTATCACAAAATATGTGGAATAGTGATTTAAAATGTAAAGTTGCAACATACATGTTTAAAATGGAAACACAAAGAAAAAGCTGTGAAATGTCTTGTGTCTTATGTTCTCTGTATTTATGCAACTGATCTGTCTTACTGAAGTCTGGGTCCAAGGACTCATCTCCAACCAGTTTGCATCTGTAATCCACAAAGATTCTGGGCAGCTCCCACCTCAGTCTCTTCTCTGTATTATCATAATTTGGTTTAAATAAACTATATAGTAACAATG