Transcript asmbl_75991

Sequence
Transcript Sequence for observation asmbl_75991 of TGE0007325:
CTGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCGAGCCCGCGCTCGTGTGCAGGCCCGGCTTGGTTCCTGGTCTCTGGTGCGAGGGTTCACACGAGGCCCCGGCCTCGGACCCCGGACTAGGCCGCGACCCCGGGCGCCATGAAGCAGGAGGGCTCGGCGCGGCGCCGAGGGGCGGACAAGGCGAAACCGCCACCCGGCGGAGGGGAACAAGAACCACCGCCACCCCCGGCCCCCCAGGATGTGGAGATGAAAGAGGAGGCGGTGGCAGGTGGCGGATCAACGGGGGAGGCTGACGGCAAGACGGCGGCGGCGGCGGCTGAGCACTCCCAGCGAGAGCTGGACACCGTCACCTTGGAGGATATCAAGGAGCATGTGAAACAGCTGGAGAAGGCAGTTTCAGGCAAGGAGCCTCGATTTGTTCTGAGGGCCCTGCGGATGCTGCCTTCCACATCACGCCGCCTCAACCACTATGTTCTGTATAAGGCTGTGCATGGCTTCTTCACCTCAAATAATGCCACTCGGGACTTCTTGCTACCCTTCCTGGAAGAGCCCATGGACACAGAAGCTGATTTACAGTTCCGTCCCCGAACAGGAAAAGCTGCATCAGCACCGCTGCTGCCTGAAGTGGAAGCCTATCTGCAGCTCCTCATGGTCATCTTCCTGATGAACAGCAAGCGCTACAAAGAGGCACAGAAGATCTCTGATGATCTGATGCAGAAGATCAGCACTCAGAACCGCCGGGCCCTGGACCTTGTGGCTGCAAAGTGTTACTACTACCACGCCCGGATCTATGAGTTCCTGGACAAGCTGGATGTGGTGCGCAGCTTCTTGCATGCACGGCTCCGGACAGCCACCCTTCGGCATGACGCAGACGGGCAGGCCACCCTGCTTAACCTTCTGCTGCGGAACTACCTACACTACAACTTGTACGACCAGGCTGAGAAGCTGGTGTCCAAGTCCGTGTTCCCTGAGCAGGCCAACAACAATGAGTGGGCAAGGTACCTCTACTACACAGGGCGGATCAAAGCCATCCAGTTGGAGTACTCAGAGGCCCGGAGAACAATGACCAATGCCCTTCGCAAGGCCCCTCAGCACACAGCTGTCGGCTTCAAACAGACTGTGCACAAGCTTCTTATTGTGGTGGAGCTGTTGCTGGGGGAGATCCCGGACCGACTGCAGTTCCGTCAGCCATCCCTCAAGCGCTCGCTCATGCCCTACTTCCTTTTGACCCAAGCTGTCAGGACAGGAAACCTAGCCAAGTTCAACCAGGTCCTGGATCAGTTTGGGGAGAAGTTTCAAGCAGATGGGACCTACACCCTAATCATCCGACTGCGGCACAACGTCATTAAGACAGGTGTGCGCATGATCAGTCTCTCCTATTCCCGAATCTCCCTGGCCGACATCGCCCAGAAGCTGCAACTAGATAGCCCAGAGGATGCAGAGTTCATTGTTGCCAAGGCCATCCGGGATGGCGTCATTGAGGCCAGCATCAACCATGAGAAGGGCTACGTGCAGTCCAAGGAAATGATTGATATCTATTCCACGCGTGAGCCCCAGCTCGCCTTCCACCAGCGCATCTCCTTCTGCCTAGACATCCACAACATGTCTGTCAAGGCCATGAGGTTTCCTCCCAAATCATACAACAAGGACTTGGAATCTGCAGAGGAACGGCGTGAGCGAGAGCAGCAAGACTTGGAGTTTGCCAAAGAGATGGCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTGGGGTGAGTGGGGACTGGCTCTTTATCTTTCCCCTCAGGGGTCCCATGCCCAGGGAACTGGCCCTTTTTCCCACACACAGCTCACAGACTGCATATGTGCTGGGGGCGGGCGGGGTGAAGGGTGTAGAGAGCCAGCCACCCCCACCTCACCTCAGGGCCCCTCCCCAGCCGGTGATTTAGCACACAGTGGTCAAGAGGGCGGGCAGACAGCCTCCCCAGGGCAGGGTCCTGGCTAGTGGTGTGGGCAGCAAGATGGGAGGGAAAAGCCCTGTGCTCTCCTCCAGGGAGTAGGGGACTGGAACTGGGACATGTGTCGGGTTGTATGTTTTTTGAAGCTTCAATTATGATTTTTAAACAATAAAAGTTCTCCAAAGCAT