Transcript asmbl_75968

Sequence
Transcript Sequence for observation asmbl_75968 of TGE0007322:
GCCCCAGTCACTGAGCCGCCGCCGAGGACTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCCGACGCTCCGTCCCCCCTGCCCGCCTTCTCCCGCCGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCGACCCCTTTGCTGATGCAAGTAAGGGTGATGATCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACTACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTAGTGAAGGCGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTCGTAGAGATTGGTCTGGCTAAGGACGACCAGCTGAAGGTTCATGGGTTTTAAGTGCTTTTTGGCTCACTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCCCTTCTGTCCCTTGTCACAAGTTTAAAAACCTCACAGCTTGTATAATGTAACCATTTGGGGTCTGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACTGAAAAGAGCCATGCTGTCTAGTCTTGAAGTCCCTCATTTAAACAGAGGTCAAGCAGTAGGCACCCGGCAGTGTCCAGCCTGAAACAAAGCAATAACGTGATGTTTCGGCCAAGCTCAGAGCCCCAAGATCACAGATGGCTATGTCCAGCCAGAAGCTCCTCGGCTCTCCCTCTACAGAATTCCCTGCCCTAAGAGAATGTCACCACCTGAACAGCCTTCGGTGAAGCTTGAGAGAGGATGGGGTAAGGCAGCAACAGCAGCTGTGCCACTAGAGGGAGCCTCCAGTAGTCAAAGATCCCTTGGTGTCTCCAATCTGACCAGGTGGGTGGAGCTTCAGGCAGTCACCTTCCCGCTGTTGAGGTGATAAGGACACCTGGCTTGCCACCAAGGTGTTTTTGATAAGAAATGTCCTAACCGATGTCCAAACACAGAATGTGAGGCCAACCTTCTATCAGAGTTAAACTTTTGACAAGGGAACAAGTTTCAAACTGATGTGTCATGTAGCTAGCTGTAGAGCTTGCAGTTTACTAGCAAGAGCTGCCCAATGCCATGTGAAGTAACAGATTTTTGGTTTTTTCCCTTCAGTTTTAATGTTATGTAATGTATTTAAACCCTTATTTAAATAAAACTTGTTTTCAG