Transcript asmbl_75867

Sequence
Transcript Sequence for observation asmbl_75867 of TGE0007304:
AGGTTGACTTTTCACCACACTGAAACCATTAGGAAAAATCCTTGTGGTTAACAGCAGAGGCTTCAGAGTGTAACCTGTACTGGGGCCTAGAAATTATTTTAAATGGCGACTGATACGTCTCAAGGTGAACTCGTCCATCCTAAGGCACTCCCACTTATAGTAGGAGCTCAGCTGATCCACGCGGACAAGTTAGGTGAGAAGGTGGAAGAGAGCGCCATGCCGATTCGTCGAGCTGTGAATTCTACCCGGGAAACTCCTCCCAAAAACAAGCTTGCTGAAGGGGAGGAAGGAAAGCCAGAACCAGACGTAAGTTCAGAGGAATCTATCTCTACCGTAGAAGAACAAGAGAATGAAACTCCACCTGCTACATCTAGTGAGGCAGAGCAGCCAAAGGGGGAACCTGAGAATGAAGAGAAGGAAGAAAACAAGTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATACCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCCTCCCCACGTCCCAAGATGGATGCAATCCTAACGGAGGCCATTAAGGCGTGCTTCCAGAAGAGTGGTGCATCAGTTGTTGCTATTCGAAAATACATCATCCATAAGTACCCTTCTCTGGAGCTGGAGAGAAGAGGCTACCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGTGTCATCAAACAGGTAAAAGGAAAAGGTGCTTCTGGGAGTTTTGTGGTGGTCCAGAAATCAAGAAAAACCCCACAGAAATCTAGAAACAGAAAGGACAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAAGATATCCTCCCATTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGAAAATACGTGTCTCAGTATTACCCTAAACTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAATGCTCTGCAAAGAGCAGTAGAGAGAGGCCAGTTAGAACAAATAACTGGCAAAGGAGCTTCTGGAACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGACCAATTCTAACTATCAAATGCATCTGCTAAAAAAAACCTTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGTAAAGGATTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTACCCCAGCCCAGGAGTTCTATTTCCAAAGAAAGAGCCAGATGATTCTAAAGATGAGGATGAAGATGAAGATGACTCATCAGAAGAAGACTCTGAGGATGAAGAGCCTCCACCTAAGAGGTTACAAAAGAAAACCCCAGCCAAGTCATCAGGGAAGGCTGCATCCATGAAGCAGAGAGGGTCCAAGCCTCTACCGAAAGTCCCAGCTGCCCAGCGGGGGAAAGCTAGGCCCCTGCCCAAGAAAGCCTCTCCTAAGGCCAAAACTCCTGCCAAGAAAGCTAGACCCTCACCCTCAGTCATCAAGAAACCTAGTGGTGGCTCTTCAAAGAAGCCTGCGGCCAGTGTGAGAAAGGAAGTGAAATTGCCTGGCAAGGGCAAATCTACCATGAAGAAATCTTTCAAAGCAAAAAAGTAAATTTTATAGGGAAAAAAGGGTATCATGATGAAATTTAAAATCTTATTTTATAAGGTCAGTGTGCATTTGTTTTAGTTTTGATGCTTTTAAAATTATATTTTTTCCTTCCCCTCAGAACATTGTGAGGAGGGAATATAAATAAACCAGTTTAGGCATTCGTTAGCTTTTGGCACTATTCTTGGTGTCTGCCCCTTCCCTCGGTCATTTCATTTTCTGCGATAATTCTGGACTTGCCTGAACTGTATAATCTATACATGTCTATTTTTCTCCCTCCACCCCAACCCTCTTTTTGTTTGTTTGTTTGTTTGT