Transcript asmbl_75749

Sequence
Transcript Sequence for observation asmbl_75749 of TGE0028790:
ACTGAAGCGAGCATGTGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAATGAGAAAACTGAGGCATCAGAGAGGTGAAATTGCTTCCCCAGAGTCACACAGCCAACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGC