Transcript asmbl_21084

Sequence
Transcript Sequence for observation asmbl_21084 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTGGGGGCTTGGAGTGGGGTGGGTTGGGAGAATGTCAGTGAGTGGAAGTGTGGGTCTCTGTGCA