Transcript asmbl_75632

Sequence
Transcript Sequence for observation asmbl_75632 of TGE0017362:
AATGTTCTTGGATGTTCATCAGTAATTCAAGGTCTTAGATAAGTTATGAAATGTGATTCTTAAAAGAAACTGAACACTTTTCCAATTTTGTTTTTCTAAGAATTCAGGTATTGAAAAAGCTTTTCTCTTCGATGTTGTTAGCAAAATCTACATTGCAACAGACAGTTCTCCTGTGGATATGCAATCTTATGAACTTTGCTGTGACATGATTGATGTTGTAATTGATGTGTCTTGTATATATGGGTTAAAGGAAGATGGCAGTGGAAGTGCTTATGACAAAGAGTCTATGGCAATTATCAAGCTGAATAATACAACTGTCCTTTATTTAAAGGAAGTGACTAAATTTTTGGCACTGGTCTGCATTCTTAGGGAAGAAAGTTTTGAACGAAAAGGTTTAATAGACTACAACTTCCATTGTTTCCGAAAAGCTATTCACGAGGTTTTTGAGGTGGGTGTGACTTCTCACAGGGGCTGTGGTCACCAGACCAGTACCCCCAGCCTGAAAGCATTGACACACAACGGCACACCACGAAATGCCATCTAGCCCGAATTCCAGTGGTCGGGGCTCTGTGCCAGCTTACTCTTCCCTCCAGGGTCAGATGCCACGTGCTCCAGGACATGGGAGTTGCCGCT