Transcript asmbl_74229

Sequence
Transcript Sequence for observation asmbl_74229 of TGE0007199:
GGCTTGGTTTGTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACA