Transcript asmbl_20451

Sequence
Transcript Sequence for observation asmbl_20451 of TGE0004149:
CTAGCTAAGGAGTCGGCCGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGCAGGGTGCGGGGCGGTCGGGGGGGGACCCGCCGCGGCTGTTGCCACCGCCGCCACCACCGCCTCTGTGCTCGTGGCGTGGGAAAGGAGGCGTGAGTCCCGGGCGCGAGCCGCCGGCGGCGCCGCTACGGGAGGATCGGTGGTGGGAAGGCGATGGCGGATATAGATAAACTCAATATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTACAGGAGAATGAAATCAGAGGATTGTGCTTAAAGTCCCGAGAGATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGATATCCATGGGCAGTACTATGATTTGCTTCGACTTTTTGAGTACGGTGGTTTCCCACCCGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGGAAGCAGTCATTGGAGACTATCTGCCTTTTATTGGCGTACAAAATCAAATATCCCGAGAATTTTTTTCTTCTCAGAGGAAACCATGAATGTGCCAGCATCAATAGAATTTATGGATTTTACGATGAATGTAAAAGAAGATATAACATTAAACTATGGAAAACTTTCACAGACTGCTTTAATTGTTTACCAATAGCAGCCATCGTGGATGAGAAAATATTTTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCACCCAATTATTGTGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGACGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCGAATGCCACAAGACCTGTAACACCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCATTTTGACACTGCCTAGTTGGGACTTGTAACATATAGTATATAACCTTCATTTTTAAAACTGTAATGTGTATTGGTCAGCTTGCTCAAACAGTGTGTTTGTGGGGCCCTCCCTTCCATTTTTGACTTAATGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGATTCTCTACTCCCAAGAAACAATATTTTGTTTTTAATTCTCTATTCCTTTTACAAACAATTTTAATGATGGTGTTAAAGCTGTATGCCCCAGGATGGTTTATCCTGTCTGAGGGGTAAGTGTACAATTGACCTTTTTTTTTTAATTCAGTACAGCCCATGAATCATGTAAATGCTCGTTTTCTTTAGGATATAAAGAGAGCCCTAGGGTGCTCAATCTGTACATGTTATCGTCATAAAATGCATACTGTTGATACAGACCACTGTGAACATTTTTTTAATTTTAAGATTTTGTTTCAAAGGGATTGCTTATTTCTCTCATTGTCTTGTCATGTACAAATTGGTTTTTATTGCTATCAACATTAGAAGTAACTTTCAACCTTGCCAGCATCACTGGTATAATGTATGTTTAATTAAAGCACACTTTCCTCTACCGAATACTTAAAACGAGAATTAAAGCCATTATTTTAAATGTTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAAATACGTATTGACACACCCCTAAGAACAAAATGGCATAGTTTTATACCCATGCCGCCTTGTTGGGGATTCAAAAACAGGTTTTTGAGTTAAAATAGCAATTAGTAATATAGTGCAGTTTAAGCTATTAATGATTAAAGTTAATAACATTTTGTACAATTTCCATATAGTCTATTCATTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACACTCTTTATTCTGCGGTGAAATTGAGGCTTATAAGTCAAACAAAGGAACTAACTTACTATCCACCAGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAAACTAAGATCTGTTAAAAAGAAATCTGTTTCAACAGATGACCGTGTATAATACCATGTGGTGAAAGTGAATTCAGACTTATTAAATGATGAACTTGTTAAATCCTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTAAATCGATTTTAATGAATAAATGGCTCTGGAAACCACACAGTTTCAATTTGGGTTTGTCTTCCTTCAAATAGTCTGTTTTCCAAAGATGGATCGTAATGTGGATGC