Transcript asmbl_17305

Sequence
Transcript Sequence for observation asmbl_17305 of TGE0000420:
AGAGGAGACTCGGGGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGTTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGGTCAGTAACAGAACACCCTTCTCCGTCCCCTCTACTCAGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAG