Transcript asmbl_71964

Sequence
Transcript Sequence for observation asmbl_71964 of TGE0007081:
TGGGAGACAAGAAGAAAACAAAGAGTAGGACCTACTTTAAATAGATAACAAGCACTCCTTGTTGAAGGAAACAACAATTAAACAAAGCTAAAGAACAAATGAGCTAGTCACGTGGAAGTCCGACAGATCATTCTAGGCCACAGTAATGGCACACGGAAAAGTGAGAAATTCAACCAGTATAGCTGGATTGCAGTGATCAAGGGAGAGCCATACAAGAGGAGGCCGGTAAGGGCAACAGGTGCCTTTTACTCAGAAGCAGACGACAGAAACAGCAGGATGGTGGTGGATTAGCAAGAGTTCTGATTTAGACACTTTAGGTGTGACGTGCCTATCAGACATCTACTGTCGGGCCGCTGGATACTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAGCCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAACGATGCTGACTTTGAGGAAAAAGTGAAACAATTGATTGATATCACAGGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTACTGCTGGAAGGAAACCCAGATACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTTTCAGGACAGAAGGATGGTGGCCAGACGGAGTCCAACGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGTGGGCGAGGTGCCAGCCGTGGACGAGAGTTTCGGGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGAAAGAGGGCGAAGAGGTCGCGGACGAGGCAGAGGTGGCTCCGGTAGGCGGGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCCGATTATGCAGAGCCAGCCAATACTGAAGATAACTATGGCAATAATAGCGGCAATACGTGGAACAACACTGGCCACTTCGAGCCAGATGATGGGACGAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTGCGTGGAGGACTGCAACCGAGGAGTGGGGAACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCAGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTACTGGGGAAGACACCGTCTTCAATGGAGAATGATTCCTCTAATCTGGATCCATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTTTTCAGTAACTCGAAGCAGAGCACCATATCACAGCCTGCTTCAGGGAGCACGTTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACGGGCTCCCAGTTCTTGGAGCAGTTCAAGACTGCGCAGGCCCTGGCTCAGCTGGCCGCCCAGCATTCCCAGTCCGGAACCGCCACCACCTCCTCTTGGGACCTGGGCTCCACCACGCAGTCCCCTTCGCTGGTGCAGTACGATTTAAAGAACCCAAATGATTCAACAGTGCACAGCCCCTTCACAAAGCGCCAGGCTTTCACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGCCACCTGCAGCAGCTACCTCCACAGCTGCACCTGCACCCCCCTCTTCTCCGCTGCCAAGCAAACCTGCCTCGGCGCCACAAATGTCCCCTGGGTCTTCAGACAACCAGTCCTCCAGCCCTCAGCCGGCTCAGCAAAAACTGAAGCAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCGGCAGATATCTCAGGGCTAAACCTGCAGTTCGGGGCCTTGCAGTTTGGGTCGGAGCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCGAGTAGCCTCTATACCAGCACGGCCAGCGAGTCTTCGTCCACAACGTCATCCAACCAGAGCCAGGAGTCCGGGTATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAACAGTGCTCAGGGCCCTCTGTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTCGAAGGTGCTACAGGCTCTGCCGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCACTCAGCGAAACGGTCTCTGCAGCCTCCTTACTGACGACGACCAATCAGCACTCGTCCTCCCTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTGCCACCACACAACACAGCAGCACGTTGTCCACGCAGCAGAACTCCCTGTCCACATCAGCATCTTCCGGGCGCACTTCGACGTCCACTCTTCTGCACACGAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCACCCCCCGCAGCGGTCAGCGTCTCCTCCGGTCTCAGTAGTGGCAGTAGCCTGGGCCTCAGCCTCGGCAGCAGCTCCACCGTCACGGCCTCGACACGAAGCTCAGTTGCCACGACTTCAGGAAAAGCTCCTCCTAACCTCCCGCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTACATCATGGCTCCGGGGCTGTTACATGCCTACCCGCCCCAAGTGTATGGTTATGACGACTTGCAGATGCTTCAGACGAGATTTCCGTTGGATTACTACAGCATCCCGTTTCCCACGCCCACCACGCCGCTGACTGGGAGGGACGGTAGCCTGGCCAGCAACCCTTATTCCGGTGACCTCACAAAGTTCGGCCGCGGGGATGCCTCCTCCCCGGCCCCGGCCACAACCTTGGCCCAGCCCCAGCAGAACCAGACGCAGACACACCACACCACACAGCAGACGTTCCTGAACCCGGCGCTGCCTCCCGGCTACAGCTACACCAGCCTGCCGTACTACACAGGGGTGCCGGGGCTCCCCAGCACCTTCCAGTACGGGCCTGCCGTGTTCCCTGTGGCTCCTACCTCTTCTAAGCAGCATGGCGTGAACGTCAGCGTGAATGCATCGGCCACCCCCTTCCAGCAGCCAAGCGGGTACGGGTCTCACGGATACAACACTGGAAGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCTGGGGGCTGTGTTTTGTGTGTGTGTATGTTTGCACTGAAGTCTTGTTTCAGAAACCAGAGCACTGAGGAGAGCCTGCCGAGCTGTGGCCACGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATGCCTTCTGGGCTCTTGAACTTGCCCGTCCCCCGCTTCCCCTCCTCCATGTGTCTGACCCTGTCTTACCCATTTCGAGTCCGAGCGGTGCAGCACCTCCGAAGCATCGATGCACACACACCCGCTGTTGCTTTTAATTTCTGGAAGGCATGTGGTTGCAACTTGTAACAAAAACCTTTGTAGTCTTCAATAAACTGTGGTGTTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCATGTCTCTCTGGACACTAGGATCCAGTGTTGTGCTGTGGATGAAGGGTGGAGGGTGGCCTTTTCAGTCGGACCCCCGCACAGTCAG