Transcript asmbl_7160

Sequence
Transcript Sequence for observation asmbl_7160 of TGE0006793:
CGACGACGGCGGCGGCGGCGGTGGTGGGTCCATCGCTGGACGGCTAAGGGGAAAGCCAGGCCTGAGCTTCTGCATCTAGGATCAGAATGGTTTCAATCCCAGAATACTATGAAGGCAAGAATGTTCTTCTCACTGGAGCTACTGGTTTCCTAGGGAAGGTACTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAAGTGAATTTAGTGTATGTTCTGGTGAGGCAGAAAGCTGGACAGACACCCCAAGAGCGAGTAGAAGAAGTCATTAGTGGCAAGCTCTTTGACAGATTGAGAGATGAAAATCCAGATTTTAGGGAGAAAATTATAGCAATCAGCAGTGAACTTACCCAACCTATACTGGCTCTTAGTGAAGAAGATAAAGAGATCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTAAGGTTTAATGAAAATTTAAGAGATGCTGTTCAGTTAAACGTGATTGCCACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAACCTGGAAGTGTTCACACATGTGTCAACAGCATACGCCTACTGCAATCGAAAGCATATTGATGAAGTAGTCTATCCACCCCCTGTAGATCCCAAGAAACTGATAGATTCTTTAGAGTGGATGGATGATGGCCTAGTAAATGATATCACCCCCAAATTGATAGGAGACAGACCTAATACGTACATATACACAAAAGCATTGGCAGAGTATGTTGTACAACAAGAAGGAGCAAAGCTAAATGTGGCAATTGTAAGGCCATCAATCGTTGGTGCCAGTTGGAAAGAACCTTTTCCAGGATGGATTGATAACTTTAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAGTGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACATGAGTCTTGCGGCAGCCTGGTATTCCGGAATTAATAGACCAAAGAACATCATGGTGTATAATTGCACAACAGGCAGCACTAATCCTTTCCATTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCAGTACTGGATTGCTGTAAGCCATAAGGCGCCAGCATTCCTGTATGATATCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAAAACAATAACTCGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGACAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACTTTTAATATTGATGTGCGGCAGTTACATTGGGCAGAGTACATAGAGAACTACTGCATGGGGACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGCCTCCCTGCAGCTAGAAAACATCTGAACAAGTTGAGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGTATTTTTATTGCAAGATCACAAATGGCAAGAAACATCTGGTACTTTGTGGTTAGTCTGTGTTACAAGTTTCTGTCATACTTCCGAGCATCCAGCACTATGAGATACTGAAGACAAGAATTTAGCATTAGAACATCTATGCATATGGTGGTCTAAATGCACAAAACGTAAAATGTACTTAAGTCATGTCATCTTTTGTCAAGACATTAAACCATCTTAGATCAGAGAGTGGAGTAAATTATGGTACATTTTATGTAACGTTTTAATGTTTATGCTCTTAAAAATCTAGTGAACACACTGTGGTATGCCATCTCAATTCTGCAATAGCCACCAAAACCATGACTTAATATTTTGATCCCTCGGGAAAAGGGGTGGGGTGAGGGTAGGAGTGGGGATATAGGAACACTGACCAGTATAACTGTGCAATTCTGGAACATATTAATTAAAATATGCCTTAACATATAGTGAATTTCTAATTCTAATATTGAATGCAATGGAAAGCATTTATTTGGACAGGAATACGAGCTAAGTTGGTAGATATTTGATTCTTCAGTGTTTAATTTTTTTCATCAGTCGATGTGGGTTTTAGTTTTGTTCAAGTTATAGCCAAACTATTTTCACATCATCCTGTAAGTTATCGAGTGGTCTCAGACATGAAAGATGTGTTCTCATTTTTCTTTCTCTGATTAGAGGTCTCATGCATATCATTTTTCTATAAGCAATCAGTTGCTTTCATAATCAGAAGGCTATAATTATTCTAAAGATCCTAATAGATCGAAATGGGCTTGAAAATCCATATCAACATATGCTATGTGTTTTTTGAAGGAAAATTAAAATGAATTCAGTAAGACTTGGCATCAAAAATTAGGATACATTTTTTTGTTCACATTATGGCAAATAAAAATCCTGTGAGATGTTGTTCATGTTTTTAAGATGGAGGATTTCTTGAGACTTTGG