Transcript asmbl_70295

Sequence
Transcript Sequence for observation asmbl_70295 of TGE0002143:
GCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAACCGGTGTCCTACGTCAGAGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCACTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACAAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAACGGCCTGGTTGTTTACTGTGGTACAATTGTAACGGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCGGATGATAGCAAGTTTGGCTTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACATGGTAGGGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCTGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTCGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTGCAATCAAAAGTTTTAAAATTAGTTGATATATCTTATGGTGGTGAAAATGGATTCAACCAGGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCATAGGAG