Transcript asmbl_20264

Sequence
Transcript Sequence for observation asmbl_20264 of TGE0004126:
GGGAGGAGTTCATACAAGTGCGCAGTGCCAGCTGCAGCAGTACGGCCCTTTGGCGTTCATCCTTGGCGACAGGACGACCAAAAAGCTGACAGAACGCAGCAGAGTGATAACCGTCGATGGCAATATATGTTCCGGGAAGAGCAAGCTTGCGAAGGTGGTAGCGGAGAAGCTAGGCTTGAGGTACTTTCCTGAAGCCGGGATCCATTATGCGGACAGCACCACGGGGGACGGAAAGCCGCTCGACGTGGAGCTCAGTGGCAACTGCAGCTTGGAGAAGTTCTACGACGACCCGAAAAGCAACGACGGCAACAGTTACCGCCTGCAGTCCTGGCTGTACGCCAGCCGCCTCCTGCAGTACGCCGACGCCTTGGAGCACCTGCTGAGCACAGGACAGGGCGTCGTGCTGGAACGCTCCATCTTCAGCGACTTCGTCTTCGTGGAGGCCATGTACAGCCAGCACTTCATCCGGAAGCAGTGTGTGAACCACTACTACGAGGTGAAGAAGGTCACCATCCGGGAGTACCTGCCCCCCCACGTGGTCATCTACGTCGACGTGCCCGTTCCAGAGCTCCAGAGCCGGATTCAGAAGAAGGGAGACCCACACGAGATGAAGATCTCCGCCGCCTACCTTCAGGCCATCGAGAATGCCTACAAGAAAACCTTCCTCCCTGAGATGAGTGAAAAATGCGAGGTCTTAGTGTATAGTGCGAATGAAGCTCAAGATGCGGAAAAGGTGGTGGAGGATATCGAATACCTCAAGTATGACAGAGGGCCGTGGCTCAACCAGGACGACCGTACCTTCCACATTCTGCGGATGCTGGTTCAGAATAAGTTGGAGGTGCTGAACTACACAACCATCCCGGTCTATCTCCCAGAAATCACGATCGGAGCTCACCAGAGTGACAGAGTCTTCCAGAAGTTCGTCGAGCTGCCAGGCCGCAGGTACAGCCCCGGGTACAACGCGGACGTGGGTGACAAGTGGATCTGGCTGAAGTGACGGCACGGCCTCCGCCAGAGCCGCTCCGTGGGACGCAGACGCCCGGCCGGCCGACCCGCACACTGTGGCTTTAGAACTGGGGGGAGTAGACGGTCCGAAATCGCAGGGTGCGGCAGCGGCACAGAGCAGGTGCCCGCAGGGTCGTCGGGGTGGGGGGACCTCGCCACCTCACTGTGGAGTAAGCACCGTTGTCGCGAGGGGAGCGCGGTCTGCGGGAGAGACGGGCGCCACCGGCACAGCCCCCCCGGCTCCCCTCGCGCTGTCGGGCACGTTTGTATGTCGCTCCCTCAGACTTGGAGAAATACAGCAGCTTCTGTGGCGCTTC