Transcript asmbl_69639

Sequence
Transcript Sequence for observation asmbl_69639 of TGE0006944:
CCCAGCCATTTGCTGGGTCCTGGAGGGAGGCGGCGGCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATAAATTTGTGTAATCATATTTAAAACAGATAAAATCAAGATTTGCCTTTGTCAGTAATCATCAATTTGTTTAAGTATAGACTATACTTAATAGCAAAAATCACATAGCTAAATGTTAATTAAGGTCCAAAAATTTACATACAACTTTTTAAAAATGAAAGTAATGAGTCAGCTTTTATAAGACACAGCTAAAAAATATAAACTTTATTTTACTTTGTACTCAAAAGAAAATTAAATCCAACTGCTGTTAGGGACATTGTAGAGAAGAAAACTAACCAAGAAAAACAAATCTTATGGAATCTTAGTATGTTAATCAGACTGGTAGCTACAAAATGAATATACACATTACTAAGACAAGAAACAAGTATATTCAGAACTACTTGATTTTAGAGGTTTTTTGTTGTGAAATTCAATAATTATGCTGTTTTATATTTTGTTCTCCTTGTGAACTTCTTCTTTCATACAATTACTTAACATAGTTACGGCTAGCTTATAGTATGTTTTTTTTAATTTTGTGCAAAAAAAATTTATTCTATGTATTTGACAATACAGCATACTTTACAATATTGGAAAATGGAGTATTTTTTAATGTATTACAGCAATTATGTTTCTAAACATAAGGTCAAAGATGTAGTCTTAGAATAGGACATGAAATTAAATTTTATGTAGCTTGGATGTATCATTTAAAAAAAGTGAATGTATACGTATTGGTCATATTACCTTTATTATAACCATATTAATATCTATGCTTTATACATAACCTTGCCTTGTCTTAGAAAAACACATACCTTAATCAGGAATTCAAGCAGCTTCATATAATACCAACTAAAAATAGGTACACTGGTTGAGATTTATAAACTCAAATTTATTTGCCACAGCTACGATTATTTAAAAAAAATTTTTTTCTCCCTTTTTGGGAAACATTAAAATTAATTTCTGCCATCTTAGTATAAGAGAATGATGTTGATATGTTTCAAGTTTTTCACTTCAAATTTCATAATTAATTGAATTTATTTGCTATAAGTAAGAAGTATAAATGATACTTTTAAATTGGAAAAGGGATGTTTAAGTGTCAATTTTAGGTCAAAAAGTCATGAATTATTCTACTTTATCTTATTCTGAAGTTTCTGGACCATTCTTTCTCGATAAACTTGGATGCAAAGCAAACTTTGTGAACATTATTTAAATGTTGCTGTGTTATTTAAAAGAAAGTTGCCAAGATGGACTTCTAAAGGGAAAATGATTGTTTTCTCCAGAATTTTCTAAAATATTGTTTTGGCATTAAAAATATCTCAGGATGCTACTACTCTGCCATTAAAATATTTGTATGCATGTATTAAAAAGTATGCATGTACTTTATGAGATAAATTCTATTTCGGTTTTCAGATAACTTTATTTTTTAGTGTTCTTTTAGAGTTCAAAGAATTACAGAAGATTGAAATTAATCAATATATATAGTTAAGACTGCATGAGTTCTGAAGTTTCAAACAGTCTTTGCATTTGACAGTAAGAATCGAAATCCCTTCCATGTGCCTTTGTCAGCTAATTTATGACCAGCAGTGAAAACTTTAAAAGTATATAGGGTCTGGATGTTAAATTCTTAAATACCCTACACCAGAAATATGGAGCAGAAAAGTAACTATTTACCTATATCTTAATCACTTTGAAGATGCATGGACAGAACTCAGCTGCTTTGTTTACATATCTTACATAGACAGGTCTCTCCTATTGCCAGAGGTCCCACTGCTATCTTTGCTCACTCTTCTCTTAATATATGAATTAATATTTCTGAAAGTTCAACTTTTTAAGCCTCTAACACTTTAGGGTATTTTATGTAGATACAGTGCTTTCTTCCTCAATAGGGCTATCATTGGAACCCTTATATGTGGGAAAAGAGGAAGCAGTTGAAAAGTTCTAAGTGGAACAGAAGACAAACTTGGTTTAGTTCATACTATTTTTCATGGAGCTTTCTCTAGCTGTGGAAAAACTCAGGCTAGTAAGTATCTATTTAAAGTCTTGCAACGCAATTTTAAATAATTCATAGTTCTTACCATATTTCTAAATGCTCTTTTTCTTACCAAGCCTAATATAATTGGGAAAAAATGTCTGGATACAAATAAAACATTCTTTAGATCATGTTCAAAGCCTTATTAACATTGCACCTGAAATGACAGGCCACTCTGCCTCACTTATTTGCCAAAATGCCATTTCTAAGTTAAGGAAAATTTGAGGTAGGCTTACAGCATTCTTATTGTATTTACTTTTAGATTGTAAGCTCAATGGCAGGGGCACTATACTGATAATTATGTTTTTATATAGCAACCATTGCAGTATACTCTTGGTACTTAATAAAAATTCAGTATCCTACTGTGCATTGTTTAATTCGAATGGCTTTAAAACATATTACTATGAGAAGACAGGACTAATGTTTAAGAAAGCCCTTTTGAAAGCCACCTAGGTGGCCATCGATGGATAAGTGAATGGATAAAGAAAGCATGATGGGTAGGTAGGTAGGTAGGTGTGTG