Transcript asmbl_6892

Sequence
Transcript Sequence for observation asmbl_6892 of TGE0028542:
TGAGGTGTCCGCGGGCCAGAGGGTGGACAGGTCTGTTCTCCCTTTGTTCCTAGGTACTGGCTGGGATGAACATCTACCCGTCGGAATTTGAAAACATCAAGGAGGAGTACAATGTGCGTGGCTACCCCACCATCTGCTACTTCGAGAAAGGACGGTTTCTGTTCCAGTATGATAACTATGGGTCCACAGCCGAGGACATCATGGAGTGGCTGAAGAATCCGCAGCCGCCACAGCCCCAGGTCCCTGAGACTCCCTGGGCAGATGAGGGCGGCTCCGTTTATCACCTGACCGATGAAGACTTTGACCAGTTTGTGAAGGAACACTCCTCTGTCCTCGTCATGTTCCACGCCCCATGGTGTGGACACTGTAAGAAAATGAAGCCAGAGTTTGAGAGTGCAGCGGAAGTCCTCCACGGAGAAGCAGGAAGCTCTGGTGTCCTTGCAGCTGTCGATGCCACTGTCAACAAGGCCCTGGCAGAAAGATTCCACATCTCTGAGTTTCCTACATTGAAGTATTTTAAGAATGGAGAAAAATATGCAGTGCCTGTGCTCAGAACAAAGAAGAACTTTATTGAATGGATGCGAAACCCTGAGGCCCCCCCACCCCCAGAGCCCACCTGGGAAGAGCAGCAGACCAGCGTGTTGCATCTGGTGGGGGACAACTTCCGGGAGACACTGAAGAAGAAGAAACACACCTTGGTCATGTTCTATGCCCCTTGGTGCCCACACTGTAAGAAGGTTATTCCACACTTTACTGCTACTGCTGACATCTTCAAAGATGACCGCAAGATCGCCTGTGCTGCTGTGGACTGTGTCAAAGATAATAACCAGGACCTGTGTCAGCAGGAGGCCATCAAGGGCTACCCCACTTTCCACTACTACCACTATGGGAAGTTTGTAGAAAAATATGACAGCGATCGGACGGAATTGGGATTTACCAATTTTATTCGAACCCTCCGGGAGGGAGACTACGAGAGACTAGGGAAGAAGAAGGAAGAGTTGTAATTTCTGCCTCAGAGAAAGCTTTTCCATTACACTGTGAATGATACCTGTTTGGTTGTTCTTTCTGAATTTCCAAGTGTCTGGAGACAAAGTTTTTTATAGCCGCTTATGGCCATTTTGTACAATTTTGAAATAAAATTAAACCAATTGTT