Transcript asmbl_6890

Sequence
Transcript Sequence for observation asmbl_6890 of TGE0028541:
GGCTGTAAGTGGCGGTGGCATTTGGACCCGGCGGAGCTGCAGGCGCGGGAGCCCGAGTGGAGACCGGAGCCCGCGGTGGGCAGCGGCAGCGGGGATGGCGCGGGCAGGGCCGGCGTGGCTGCTGCTGCTGGCGATCTGGGTGGTCCTGCCAGTGTGGCTGTCCTCCACAAAAGTCTCCTCGCTCATCGAGAGGATCTCTGACCCTAAAGACTTGAAAAAACTTCTCAGGACCCGGAATAATGTACTGGTGCTTTACTCCAAATCTGAGGCTGCAGCTGAAAGTCATCTCAGGTTATTGTCCACTGTGGCCCAAGCAGTGAAAGGACAAGGCACCATCTGCTGGGTAGACTGTGGTGATGCAGAGAGTAGAAAATTGTGCAAGAAGATGAAAGTTGACCTGAGCCCAAAGGACAAAAAGGTTGAATTATTCCATTATCAGGATGGTGCATTTCATACTGAATATAACCGAGCTGTGACATTTAAGTCAATAGTGGCCTTTCTGAAGGATCCCAAAGGGCCCCCACTGTGGGAAGAAGATCCTGGAGCCAAAGATGTTGTCCACATTGACAGTGAAAAGGACTTCAGACGGCTCCTGAAGAAGGAAGAGAAGCCGCTCCTGATGATGTTTTATGCCCCCTGGTGCAGCATGTGCAAGAGGATAATGCCGCATTTCCAGAAGGCTGCGACCCAGCTGCGAGGCCACTTTGTACTGGCTGGGATGAACATCTACCCGTCGGAATTTGAAAACATCAAGGAGGAGTACAATGTGCGTGGCTACCCCACCATCTGCTACTTCGAGAAAGGACGGTTTCTGTTCCAGTATGATAACTATGGGTCCACAGCCGAGGACATCATGGAGTGGCTGAAGAATCCGCAGCCGCCACAGCCCCAGGTCCCTGAGACTCCCTGGGCAGATGAGGGCGGCTCCGTTTATCACCTGACCGATGAAGACTTTGACCAGTTTGTGAAGGAACACTCCTCTGTCCTCGTCATGTTCCACGCCCCATGGTGTGGACACTGTAAGAAAATGAAGCCAGAGTTTGAGAGTGCAGCGGAAGTCCTCCACGGAGAAGCAGGAAGCTCTGGTGTCCTTGCAGCTGTCGATGCCACTGTCAACAAGGCCCTGGCAGAAAGATTCCACATCTCTGAGTTTCCTACATTGAAGTATTTTAAGAATGGAGAAAAATATGCAGTGCCTGTGCTCAGAACAAAGAAGAACTTTATTGAATGGATGCGAAACCCTGAGGCCCCCCCACCCCCAGAGCCCACCTGGGAAGAGCAGCAGACCAGCGTGTTGCATCTGGTGGGGGACAACTTCCGGGAGACACTGAAGAAGAAGAAACACACCTTGGTCATGTTCTATGCCCCTTGGTGCCCACACTGTAAGAAGGTTATTCCACACTTTACTGCTACTGCTGACATCTTCAAAGATGACCGCAAGATCGCCTGTGCTGCTGTGGACTGTGTCAAAGATAATAACCAGGACCTGTGTCAGCAGGAGGCCATCAAGGGCTACCCCACTTTCCACTACTACCACTATGGGAAGTTTGTAGAAAAATATGACAGCGATCGGACGGAATTGGGATTTACCAATTTTATTCGAACCCTCCGGGAGGGAGACTACGAGAGACTAGGGAAGAAGAAGGAAGAGTTGTAATTTCTGCCTCAGAGAAAGCTTTTCCATTACACTGTGAATGATACCTGTTTGGTTGTTCTTTCTGAATTTCCAAGTGTCTGGAGACAAAGTTTTTTATAGCCGCTTATGGCCATTTTGTACAATTTTGAAATAAAATTAAACCAATTGTT