Transcript asmbl_68712

Sequence
Transcript Sequence for observation asmbl_68712 of TGE0006898:
TTTAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAGTAAGTGAACAATATCAACTTTGGATTAAGGCCTGGATTTGATTCATGATTGACATTTACTAGCTCTATGACTTTTGGCAAGTAACTAATTTGTGATCCCTTCAATTTCTTGATCTCTTGAATGCAGATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGAGATTTGTGTGTGTGTGTGTGTGTATATA