Transcript asmbl_68419

Sequence
Transcript Sequence for observation asmbl_68419 of TGE0006885:
CCGGAAGTAGCGTGTGGGTCTCTTCCCTTCTGTGGCCATCGCTGAAACTCCAGCGGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGTAATCATACACAGTTTTCATTAAAAACTTGTAAATG