Transcript asmbl_68418

Sequence
Transcript Sequence for observation asmbl_68418 of TGE0006885:
CCGGAAGTAGCGTGTGGGTCTCTTCCCTTCTGTGGCCATCGCTGAAACTCCAGCGGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGATTCAGCTCTGCCCCTCAACTCTTCATGTAATGGCTGGGATCCCAAGGATCTTGTTTTCCTAAGATTGTTGGAATGCCTGTGATCATACGAACTCTTCCCCTGGCCTCATCACCATCACATATCCTGGAGTTGTTCCAACAAAGGAATCTTGGTTTAGATAATCTGAGTATCAAGTTCTCTCCCTGAGGAATTC