Transcript asmbl_1998

Sequence
Transcript Sequence for observation asmbl_1998 of TGE0004118:
CAGAGCCTGGCTCAGCTAGAGAATCTGTGCAAACAGCTGTATGAAACCACAGATACAACCACTCGACTCCAGGCAGAAAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTACTCCTTGAAAGAGGAAGTTCATCGTATTCCCAGTTACTGGCAGCTACATGCCTTACAAAGCTTGTATCACGCACAAACAACCCTCTACCATTGGAACAACGAATAGATATTCGAAATTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCTACTTTTGTGACACAAGCACTAATTCAGTTATATGCCAGAATCACAAAACTGGGCTGGTTTGACTGTCAGAAGGATGACTATGTCTTCAGAAATGCAATCACAGATGTCACAAGGTTTTTACAGGATAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTAACCAATGAAATTAATCAAGCAGACACCACCCATCCTTTAACCAAGCACAGAAAAATAGCCTCTTCTTTCCGAGATTCATCATTATTTGACATCTTCACACTTTCCTGCAATTTACTAAAACAGGCTTCGGGAAAGAATCTAAACTTGAATGATGAAAGCCAGCATGGTTTACTCATGCAACTGCTCAAACTCACTCATAACTGCCTAAACTTTGATTTCATCGGCACTTCTACTGATGAGTCCTCAGATGACCTGTGCACAGTACAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCAACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATCCCTCCTTCATTTTCACCCCTGGTATTATCCTGCTTAGTACAGATTGCCTCAGTTAGAAGATCCCTGTTTAACAATGCAGAGAGAGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTTTGCAGACTACTGGCCCGACTGAAGAGTAACTATCAACTGGGAGAGTTAGTAAAGGTGGAAAACTACCCTGAGGTCATCCGATTGATAGCTAACTTCACAGTGACCAGTCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTGCCATACGTGAAAGCCACAGAGCCCCACATGCTGGAAACTTATACTCCTGAAGTCACCAAAGCCTACATCACATCCCGTTTGGAATCTGTGCATATCATATTGAGAGATGGACTGGAAGATCCTCTGGAGGATACAGGTCTGGTCCAGCAGCAGTTGGACCAGCTGTCTACAATTGGACGTTGTGAATACGAGAAGACGTGTGCGCTCCTCGTGCAGTTGTTTGACCAGTCGGCCCAGTCCTATCAGGAGCTGCTACAGAGTGCCAGCGCAAGCCCAATGGATATTGCAGTGCAGGAAGGGAGGCTGACATGGCTGGTTTACATCATTGGCGCAGTAATAGGTGGCCGGGTCTCTTTTGCCAGCACTGATGAGCAAGATGCTATGGATGGCGAGCTTGTCTGTCGGGTGCTCCAGCTGATGAACCTAACAGATTCTCGCTTGGCTCAGGCAGGCAACGAGAAGCTAGAACTGGCCATGCTGAGCTTTTTTGAACAGTTTCGTAAGATCTACATTGGGGACCAGGTGCAAAAATCCTCTAAGCTGTACCGACGACTCTCAGAAGTTCTGGGCTTAAATGATGAGACCATGGTCCTGAGTGTCTTCATTGGAAAAATCATCACCAACCTGAAGTACTGGGGCCGCTGCGAGCCAATCACCTCCAAGACGCTACAGCTTCTCAATGACCTCTCCATTGGATACAGTAGTGTAAGGAAACTAGTGAAGCTTAGTGCGGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACGACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCACTCACAGCAGCGTTTGAGGCTGTAGCCCAGATGTTTAGCACGAATAGTTTCAATGAGCAAGAGGCGAAGCGAACTCTAGTTGGCCTAGTAAGAGACCTGAGAGGAATAGCTTTCGCCTTCAATGCCAAGACCAGCTTCATGATGCTGTTTGAATGGATATACCCATCCTACATGCCAATTCTCCAGCGCGCAATTGAGCTATGGTACCATGATCCAGCCTGTACCACACCCGTGCTCAAGCTGATGGCTGAATTAGTTCATAATAGATCCCAGCGACTCCAGTTTGATGTCTCTTCCCCCAATGGCATCTTACTCTTCAGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTCCCAAAGGATCAGGTCTATGCACTGAAGCTCAAGGGCATCTCCATCTGCTTCTCTATGCTGAAGGCTGCTCTCAGTGGGAGTTATGTCAACTTTGGAGTCTTCCGTCTCTATGGAGACGATGCCCTGGACAACGCTCTCCAGACCTTCATCAAGCTGCTCCTCTCCATTCCCCACAGCGACCTCCTGGACTACCCCAAGCTCAGCCAGTCTTACTACTCACTGCTGGAAGTCCTGACCCAGGACCACATGAACTTCATTGCAAGCCTGGAACCTCACGTCATCATGTATATTCTCTCTTCCATATCTGAAGGACTCACTGCACTTGACACCATGGTTTGTACAGGCTGCTGCTCCTGCCTGGACCACATCGTGACATACCTCTTTAAGCAGCTGTCACGTAGCACCAAGAAGAGGACAACACCCCTGAACCAGGAGAGTGACCGCTTTCTGCATATCATGCAGCAGCATCCAGAGATGATCCAGCAGATGCTGTCAACGGTGCTGAACATCATCATCTTCGAAGACTGTAGGAACCAGTGGTCTATGTCCCGACCGCTACTGGGCTTGATACTACTTAATGAAAAGTATTTTTCTGACCTAAGGAACAGTATCGTGAACAGCCAGCCACCAGAGAAGCAGCAGGCTATGCATCTGTGTTTTGAAAACCTGATGGAAGGCATAGAGCGAAATCTTCTCACAAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAAGTCAACGACTCGATGAAGAACTCCACTTACGGCGTGAATAGCAATGACATGATGAGCTGACACCTCCTTGGAATCTACCTGTACAGAGCAGCGTCCCTTCGGTCTGGCCCAGAGGGGCGAACAATTACAAGGGAGAGGGCCTGGCTGATCCTGGCGCCCTTCTCCAGGGGTGTGGAGAAAATGGCAAAGGTCAACTAGCTGTTTCCCCAGGGAATAGGGGTGTGAG