Transcript asmbl_17296

Sequence
Transcript Sequence for observation asmbl_17296 of TGE0000418:
GCGCGGACTAGTGAGGACCTCCACAGCTCCTGACATTGCCAGGAGTCCTGTCGGCGTTTTCTCCCAGCCTCCGCCATGCCGGCGGTGCTGGGTTTTGAAGGCAGCGCCAATAAGATTGGCGTGGGCGTGGTGCGGGATGGCAAGGTGCTGGCGAACCCGCGGCGGACTTACGTCACGCCTCCTGGCACAGGATTCCTTCCAGGTGATACAGCCAGGCATCACCGAGCTGTTATCCTAGACCTGCTGCAGGAGGCACTAACAGAGTCTGGATTAACCTCCCAGGATATCGACTGCATTGCATACACCAAGGGCCCTGGCATGGGTGCCCCACTGGTTTCTGTGGCTGTTGTGGCCCGTACTGTGGCCCAACTGTGGAATAAGCCATTGGTGGGTGTGAACCACTGTATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGCCACCAGCCCAACCGTGTTGTATGTGAGTGGAGGAAATACGCAGGTGATTGCATACTCGGAACATCGTTACCGTATCTTTGGGGAAACCATCGATATTGCAGTGGGTAATTGTCTGGATCGTTTTGCTCGAGTGCTGAAGATTTCTAACGACCCAAGTCCAGGATACAACATTGAACAGATGGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGGATGGACGTCTCATTCTCAGGGATCCTGTCTTTCATTGAGGATGTAGCCCATCGGATGCTGGCCACAGGCGAGTGTACTCCTGAGGATCTGTGTTTCTCCCTGCAGGAAACTGTGTTTGCAATGCTGGTAGAGATCACAGAGCGAGCCATGGCACATTGTGGCTCCCAGGAGGCCCTCATTGTGGGAGGAGTGGGGTGTAATGTGAGGCTACAGGAGATGATGGCAACAATGTGCCAGGAACGTGGAGCCCGGCTTTTTGCTACAGATGAGAGATTCTGTATTGACAATGGAGCGATGATAGCCCAGGCTGGCTGGGAGATGTTTCGGGCTGGACACAGGACCCCACTCAGTGATTCTGGGGTTACACAGAGGTATCGGACAGATGAAGTAGAGGTGACCTGGAGGGACTAATAAGATCAACAGAATCAGAGTAGATAGTTCCTTAATCGGAACCCAAAGGACCCCGTGCCTCAATCTCTATCCTGATGTCATGGGAGTCCTAGCAAAGCTATAGACTCCAAGCAAGGCTTGGGGTCCTTTATGGAACCCCAGGATGACTCAGCAA