Transcript asmbl_67341

Sequence
Transcript Sequence for observation asmbl_67341 of TGE0028469:
GAACCTCGGGTAACGGCGCGAGGGGTCTGAGTACGGTGCGCGGCGGAAGCACGACCAAGTTGGGATGGCCAACAGCTGGGGGAACCTCTTGCAGAATGAGCAGCAGCTGGAGGAACTGGCACAGCAGGCTGTGGACCGGGCCCTGGCTGAGGGAGTGTTGCTAAGGACCTCACAGGAGCCCAGCTCCTCAGACGTGGTGTGCTATCCCATTCACGACACTCTTCCCCTCACTGGTCCCCAGTGCCCTGCTGGAGCAGGCCTATGCCGTACAGATGGACTTCAACCTGCTGGTGGATGCCGTCAGCCAGAATGCTGCCTTTCTAGAGCAAACGCTCTCCAGCACCATCAAAAGAGACGATTTTACTGCTCGTCTCTTTGACATCCACAAGCAAGTCCTGAAAGAGGGCATTGCCCAGACTGTGTTCCTAGGCCTGAATCGTTCAGACTACATGTTCCAGCGCAACGCAGATGGCTCCCCAGCCCTGAAACAGATTGAAATCAACACCATCTCTGCCAGCTTCGGGGGCCTGGCCTCCCGGACCCCAGCTGTGCACCGACATGTTCTCAGTGTCCTGAGTAAGACCAAAGAAGCTGCCAAGATCCTCTCCAATAATCCCAGCAAGGGACTGGCCCTGGGGATCGCCAAAGCCTGGGAGCTCTACGGCTCAGCCAATGCTCTGGTACTACTGATTGCTCAAGAGAAAGAAAGGAACATATTTGACCAGCGTGCCATAGAAATTGAGTTACTGACCAGGAACATCCATGTAATCCGGCGAACGTTTGAAGATATCTCTGAAAAGGGATCTCTGGACCAAGACCGAAAGCTGTTTGTAGACGGCCAGGAAATTGCTGTGGTTTACTTCCGAGATGGCTACGTGCCAAGTCAGTACAGTCAACAGAACTGGGAAGCACGCCTGCTGCTGGAGAGGTCATGTGCTGTCAAGTGCCCGGACATTGCCACCCAGCTGGCTGGAACTAAGAAGGTGCAGCAGGAGCTGAGCAGAGTGGGCGTGCTGGAGGTGTTGCTCCCTGGCCAGCCTGAGGCCGTGGCCCGCCTCCGTGCCACCTTTGCTGGTCTCTACTCACTAGACATGGGTGAAGAAGGGGACCAGGCCATCACTGAGGCCCTTGCTGCTCCTAGCCGGTTTGTGCTAAAGCCCCAGAGAGAGGGTGGAGGTAACAACCTATATGGGGAAGAAATGGTACAAGTCTTGGAGCAACTGAAGGACAGCGAGGAGAGGGCCTCCTACATCCTCATGGAGAAGATTGAGCCTGAGCCTTTTGGAAATTGCCTGCTACGGCCTAGAAGTCCTGTCCAGGCAGGGAAAGACACTTGTGA