Transcript asmbl_19913

Sequence
Transcript Sequence for observation asmbl_19913 of TGE0004108:
GACAGTTTGGGGATCTGGCTAGCGGGAAGGTGTGGCGGCGGGACCATCCGGGAAGATGCCCGTGGCCGTGATGGCAGACAGTGCCTTTAGTTTCAAAAAGCTGCTGGATCAGTGCGAGAACCAGGAGCTCGAGGCTCCTGGAGGAATTGCTACACCTCCAGTGTATGGTCAGCTTCTAGCTTTATATCTGCTCCATAATGACATGAATAATGCAAGATATCTTTGGAAAAGAATACCACCTGCTATAAAATCTGCAAATTCCGAACTTGGAGGGATTTGGTCAGTAGGACAGCGGATCTGGCAGAGAGATTTCCCTGGGATCTACACGACCATCGGCGCTCACCAGTGGTCTGAGACGGTCCAGCCAATCATGGACGCGCTTAGAGACGCAACGCGGAGACGCGCCTTCACCCTGGTCTCGCAGGCGTACACCTCCATCGTCGCCGAGGACTTCGCCGCCTTCGTTGGGCTCCCTGTGGAGGAGGCCGTGAAAGGCATATTAGAACAAGGATGGCAAGCCGACTCTACCACAAGAATGGTCACGCCCAAAAAGCCAGTCGCAGGCGCCCTGGATGTCCCCTTTCACGGGTTCGCTCCTTTATCAGAGCCAGCCCCGGTCCCGCCCATCCCCAACGAGCAGCAGCTCGCCAGACTCACCGACTACGTGGCTTTCCTCGAAAACTGACCGGTCCCGCCTCCCGGACCCACCCCGGAGCGCTGTGTCCTGAACTGATCCAGAAATGCTAAATTTTTATTTTCAGCTTATTGGATGGATTCAGCGCCTCAGCCTTCCTTCCTGAGTGTGCGATGGTAAAACACACATATACTGTAAAGCGCATCATGTGTATTTTGTCCTTAAGCGCCCCGCTGACTAGTTGAAGCAGGCCCGGTTTCATCACGCCACAGTGCGGGTGGGCCCGCCGGTGTCACGCAGCCCGTGTGTGTCCCAGCGGCTCGTGACTGAGCTCCCCTGCGTCCTGTAGCCAGGTGCCCGTCACCTGTGTTTCCCGGTCACGCACAGCACACCGTTCCTGCTGCTGGCCGTAGGGGCGCGCCCGGGGAGGAAGGCTGTGCCCGGCGGGACCTGCACTGTGGGGCGCTCCCATCCGCCCCCTCGGGAGAATGCGCACTCTGCTCCTCGCCCCGGAGTTGCCACTGCAGAGACGCAGCCGGGGACCCGAATGGTCTCAGGAGACCAGGCTGTTTTCCCTGGCTTCGCTGATGGTGTGAGCGCGCCCGTGGCCGCAGTGGAGGGCTTGCCGTGGAAGTGAGCCTCATTAAGACGTTCGCGAGATGCGTCACGCTGTCACACGGCCCTTCAGGAGAGGGGAGCCCTGCACAGGGATGCGTCATCCTGGGACAGAAGCCGTGAAGATGACGAGCAACTTTGTCCAGCTGCCCTGCAGCTCCCGGTTGCTCACGTTTGACCCTCGGTTCAAGCTCTGCCTTTTGGAGAAATGCGGAACGAGCCCCTCCTTTTCCCGTGTGACGCCCTCTGAGTGTTTGAAGCTGTTTATTGTGTCTTCAGGTTAAAACATCCCTGCATTCATTCATTCTGC