Transcript asmbl_67276

Sequence
Transcript Sequence for observation asmbl_67276 of TGE0006772:
GGGGAACCTCAATACCTTAGCTTCTACTATGATGGTAACATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGATGATACTTTGGGTCTGAGTGAAGCTGAGGATAGAGGAAAATACTGGGGATGGGGAGTAGTTTGTCCCTTTAGGAGCTGACAGGCTTTGTTCACCCCTACACATACATACATTCAGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA