Transcript asmbl_67266

Sequence
Transcript Sequence for observation asmbl_67266 of TGE0006772:
CGGACCAGCAGCGGGCGCCATGGTGCTGCTGCACGTGCTCTTCGAGCACGCGGTTGGCTACGCGCTCCTGGCGCTAAAGGAAGTGGAGGAGATAAGCCTGCTGCTACCGCAGGTGGAGGAGTGCGTACTTAACCTAGGCAAGTTCCACAACATCGTTCGTCTCGTGGCCTTTTGCCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTGTCTGAAGGTGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTTTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTAGGGTACACTTGCCAGACTGGAGGCGTGATAGCTGAGATCCTTCGAGGAGTTCGTCTGCACTTCCACAACCTGGTGAAGGGTCTGACCGATGTGTCTGCTTGTAAAGCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATTAGCCTTCTGGACCAGCTGGATAAGGACATCAATACCTTCTCCATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCTGAACTGGTGAAGATCATCAATGACAATGCTACGTACTGCCGCCTTGCTCAGTTCATTGGGAACCGGAGAGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTATGGACATATCAGCCATAGACTTGATAAACATCGAGAGTTTCTCCAATCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTGCACACTTATCTGCGATCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACTTGCCCACACTCAGGTACCACTTCTGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCGAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGTCTCTGGGAGCTGTGGGTTTGCATGAGGCGGGATAGAGACCCAGCCTAGCCGGAGGCTCACTCTGGAGACACGGGAGGGGAGGGGAGGAAAGGAGCTGCCTTGGCTAATAGGGTTGAAATTTCTGATCTTAAACTCTTTGCTGAATATTCTTCTCCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA