Transcript asmbl_65682

Sequence
Transcript Sequence for observation asmbl_65682 of TGE0006720:
CCACGTGTCACGTCCTTTATCGTTCTGCTGGCAACGCTTCGCTTAACGGTTCAGTTTCCCCGGGTTGCTTAAGCTTGGAGTAAGGGTCCCCCACACCTGTGGGGGAGGGTCCGCCGGACCCGGCCCAAGCTTGCGATGCAGCCAGACCCCAAGCCCCGGGGTCGGGTCAGCAGGGACCAGCCACCTTGCTCCTCCAGGAGTGGGTGTGAGCGGGCCCTAGACAGTCCTCTGGGTCACCTGCCTCTGAAAATCGTGTCTTGCTTGCCGCCACTGCTGCTAGCATGGCAGCGCCCTCCGCCTGGCTTCCTGTTTCTGGAATGGGCTGGTGTGAGCGGAGTCCCGCGAGATGCCGGGCTCGTCCTGAGCCTGCGGGACGCGGGGCCGGTTCCTCGTTACTCATCCGCACTCTTTCTTTGTGCTCTTTCTCCTTTCTCCTCCTTTAGACAAGCTGGCCAGCCCGCCGGCCTCGGCCGCAGCCTCCAGCCCTAGCTCCTCTCCATCTCCACAGCCCGTTTCAGAGCCCGACCTGTGCTCAGAGCCACACCAGCTCGCTTCCAAGGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAGGGGGTGGGTGGGTCTAGG