Transcript asmbl_65681

Sequence
Transcript Sequence for observation asmbl_65681 of TGE0006720:
CTGAGGTTTTCAGAAAGCCGTTTCTAGGCTGCCTGTGAGGTGCTCATTTGTGGCCCGGTGTTTTTCCTTTGGTGTTCCCTAACGGGGAGCATGGGCTGAGCTGGCCTTGTCACCGCCAGGGGGCTCGGCCCAGGCGCAGAGTGGACCCCCTATTTTCTGTCCGACATGCCGGCCAGAAGTGAAATGTCTGCTGGGTGCGAGGCTCGCTCCTCCTCCCTGTCTTAAAGCCTCATCCTCTCCCCGACTCAGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAGGGGGTGGGTGGGTCTAGG