Transcript asmbl_65652

Sequence
Transcript Sequence for observation asmbl_65652 of TGE0006717:
CTTGAAGTAGTTTCCTCCGCCGGCGTCTCGGGACCCCGGCTCTCAGGATTCCGGTTCGCGGCTTCTCGCCCTCTCCCCTTCCTCGGCGCAGCGGCTTCGCAGGCTCCAGAATCCTCCTGCTCCTCGCAGCCGGCCTCCCTCCGCGGCGCGACTCTCAGGGCCACGATGAGTTTGTTTGGAACAACGTCAGGTTTCGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACGGACAACCACAACCCTATGAAGGATATTGAAGTAACATCCTCTCCTGACGATAGCATCGGTTGCCTGTCTTTTAACCCACCAACGTTGCAGGGGAACTTTCTCATTGCAGGATCGTGGGCTAACGATGTTCGCTGCTGGGAAGTTCAGGACAGTGGGCAGACGATCCCTAAGGCCCAGCAGATGCACACGGGGCCTGTGCTGGGGGTGTGCTGGAGCGACGATGGGAGCAAAGTATTTACGGCTTCGTGTGATAAAACTGCCAAAATGTGGGACCTTAACAGTAATCAAGCCATACAGATTGCACAGCACGATGCTCCTGTTAAAACCATCCACTGGATCAAAGCACCAAACTACAGCTGTGTGATGACCGGGAGCTGGGATAAGACGCTGAAGGCACGTGGGGTACCCTGGCCGGGCTGCCATCCGTGCTAGCACTGTGGGCTTCCGCTCTGAGTGGGCACGCCCTGGCTTTCTCTTTTTTTCCTTTTAGTTTTGGGATACGCGATCATCAAATCCTATGATGGTTTTGCAACTCCCTGAAAGGTGTTACTGTGCCGACGTGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCCACCTTGCCCGCCCG